\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0421799928:

Variant ID: vg0421799928 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 21799928
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.00, others allele: 0.00, population size: 322. )

Flanking Sequence (100 bp) in Reference Genome:


TCATAGCTTACAACCTAAGAAAAGAAATGTTGAGATGCAGATTAGTGAATGGCATCAATAAGTTTGAAATACATAATCCAGCCAACAGGGTTACTAATTG[C/T]
GTAATGATAAATCCTAATAGGAGGTTTTGAGAACAAAGTATAGCAAGACAAGAAATCTTACAGTTATATTTTGCGGGTAACTTCCAGTGAGTTCTCTAAA

Reverse complement sequence

TTTAGAGAACTCACTGGAAGTTACCCGCAAAATATAACTGTAAGATTTCTTGTCTTGCTATACTTTGTTCTCAAAACCTCCTATTAGGATTTATCATTAC[G/A]
CAATTAGTAACCCTGTTGGCTGGATTATGTATTTCAAACTTATTGATGCCATTCACTAATCTGCATCTCAACATTTCTTTTCTTAGGTTGTAAGCTATGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.80% 15.90% 1.27% 0.00% NA
All Indica  2759 93.50% 5.80% 0.72% 0.00% NA
All Japonica  1512 74.40% 23.90% 1.65% 0.00% NA
Aus  269 25.70% 71.70% 2.60% 0.00% NA
Indica I  595 98.20% 0.20% 1.68% 0.00% NA
Indica II  465 97.40% 1.90% 0.65% 0.00% NA
Indica III  913 90.00% 9.90% 0.11% 0.00% NA
Indica Intermediate  786 91.60% 7.60% 0.76% 0.00% NA
Temperate Japonica  767 97.00% 1.80% 1.17% 0.00% NA
Tropical Japonica  504 33.90% 63.90% 2.18% 0.00% NA
Japonica Intermediate  241 87.10% 10.80% 2.07% 0.00% NA
VI/Aromatic  96 82.30% 16.70% 1.04% 0.00% NA
Intermediate  90 70.00% 22.20% 7.78% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0421799928 C -> T LOC_Os04g35760.1 upstream_gene_variant ; 4685.0bp to feature; MODIFIER silent_mutation Average:60.58; most accessible tissue: Callus, score: 77.802 N N N N
vg0421799928 C -> T LOC_Os04g35770.1 downstream_gene_variant ; 2682.0bp to feature; MODIFIER silent_mutation Average:60.58; most accessible tissue: Callus, score: 77.802 N N N N
vg0421799928 C -> T LOC_Os04g35780.1 intron_variant ; MODIFIER silent_mutation Average:60.58; most accessible tissue: Callus, score: 77.802 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0421799928 NA 9.93E-07 mr1230 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421799928 NA 2.83E-12 mr1696 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421799928 NA 5.08E-07 mr1805 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421799928 3.15E-06 NA mr1200_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421799928 NA 7.82E-10 mr1471_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421799928 NA 1.29E-07 mr1551_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421799928 NA 2.66E-15 mr1552_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421799928 NA 3.34E-11 mr1642_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421799928 NA 7.05E-07 mr1653_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421799928 NA 2.78E-08 mr1696_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421799928 NA 1.57E-07 mr1696_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421799928 NA 3.12E-06 mr1815_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421799928 NA 3.40E-10 mr1942_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421799928 NA 5.58E-12 mr1993_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251