Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0421799928:

Variant ID: vg0421799928 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 21799928
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.00, others allele: 0.00, population size: 322. )

Flanking Sequence (100 bp) in Reference Genome:

TCATAGCTTACAACCTAAGAAAAGAAATGTTGAGATGCAGATTAGTGAATGGCATCAATAAGTTTGAAATACATAATCCAGCCAACAGGGTTACTAATTG[C/T]
GTAATGATAAATCCTAATAGGAGGTTTTGAGAACAAAGTATAGCAAGACAAGAAATCTTACAGTTATATTTTGCGGGTAACTTCCAGTGAGTTCTCTAAA

Reverse complement sequence

TTTAGAGAACTCACTGGAAGTTACCCGCAAAATATAACTGTAAGATTTCTTGTCTTGCTATACTTTGTTCTCAAAACCTCCTATTAGGATTTATCATTAC[G/A]
CAATTAGTAACCCTGTTGGCTGGATTATGTATTTCAAACTTATTGATGCCATTCACTAATCTGCATCTCAACATTTCTTTTCTTAGGTTGTAAGCTATGA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	82.80%	15.90%	1.27%	0.00%	NA
All Indica	2759	93.50%	5.80%	0.72%	0.00%	NA
All Japonica	1512	74.40%	23.90%	1.65%	0.00%	NA
Aus	269	25.70%	71.70%	2.60%	0.00%	NA
Indica I	595	98.20%	0.20%	1.68%	0.00%	NA
Indica II	465	97.40%	1.90%	0.65%	0.00%	NA
Indica III	913	90.00%	9.90%	0.11%	0.00%	NA
Indica Intermediate	786	91.60%	7.60%	0.76%	0.00%	NA
Temperate Japonica	767	97.00%	1.80%	1.17%	0.00%	NA
Tropical Japonica	504	33.90%	63.90%	2.18%	0.00%	NA
Japonica Intermediate	241	87.10%	10.80%	2.07%	0.00%	NA
VI/Aromatic	96	82.30%	16.70%	1.04%	0.00%	NA
Intermediate	90	70.00%	22.20%	7.78%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0421799928	C -> T	LOC_Os04g35760.1	upstream_gene_variant ; 4685.0bp to feature; MODIFIER	silent_mutation	Average:60.58; most accessible tissue: Callus, score: 77.802	N	N	N	N
vg0421799928	C -> T	LOC_Os04g35770.1	downstream_gene_variant ; 2682.0bp to feature; MODIFIER	silent_mutation	Average:60.58; most accessible tissue: Callus, score: 77.802	N	N	N	N
vg0421799928	C -> T	LOC_Os04g35780.1	intron_variant ; MODIFIER	silent_mutation	Average:60.58; most accessible tissue: Callus, score: 77.802	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0421799928	NA	9.93E-07	mr1230	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421799928	NA	2.83E-12	mr1696	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421799928	NA	5.08E-07	mr1805	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421799928	3.15E-06	NA	mr1200_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421799928	NA	7.82E-10	mr1471_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421799928	NA	1.29E-07	mr1551_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421799928	NA	2.66E-15	mr1552_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421799928	NA	3.34E-11	mr1642_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421799928	NA	7.05E-07	mr1653_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421799928	NA	2.78E-08	mr1696_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421799928	NA	1.57E-07	mr1696_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421799928	NA	3.12E-06	mr1815_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421799928	NA	3.40E-10	mr1942_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421799928	NA	5.58E-12	mr1993_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251