\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0421568928:

Variant ID: vg0421568928 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 21568928
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:


GGAGAGCCTGGATGGCTCACACGGGCCAGGCTAGGAGTGATGCGAGCAACCAAACACACCCTGCTTAGTTCTCAAAACAAAAATTTTCATGCTGTAACAT[C/T]
AAATGTTTGGACACATACATGTAGTATTAAATATAGGGGGAAAAAATTACACAGATTGCGTATAACTTGCTAGACGAATCTTTTAAGCCTAACTGTGCCA

Reverse complement sequence

TGGCACAGTTAGGCTTAAAAGATTCGTCTAGCAAGTTATACGCAATCTGTGTAATTTTTTCCCCCTATATTTAATACTACATGTATGTGTCCAAACATTT[G/A]
ATGTTACAGCATGAAAATTTTTGTTTTGAGAACTAAGCAGGGTGTGTTTGGTTGCTCGCATCACTCCTAGCCTGGCCCGTGTGAGCCATCCAGGCTCTCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.70% 17.70% 0.25% 3.34% NA
All Indica  2759 69.60% 29.80% 0.25% 0.40% NA
All Japonica  1512 90.30% 0.10% 0.33% 9.19% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 49.10% 49.70% 0.67% 0.50% NA
Indica II  465 36.10% 63.20% 0.43% 0.22% NA
Indica III  913 94.60% 5.40% 0.00% 0.00% NA
Indica Intermediate  786 75.70% 23.30% 0.13% 0.89% NA
Temperate Japonica  767 96.20% 0.00% 0.39% 3.39% NA
Tropical Japonica  504 94.40% 0.20% 0.00% 5.36% NA
Japonica Intermediate  241 63.10% 0.40% 0.83% 35.68% NA
VI/Aromatic  96 92.70% 0.00% 0.00% 7.29% NA
Intermediate  90 85.60% 13.30% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0421568928 C -> DEL N N silent_mutation Average:61.979; most accessible tissue: Callus, score: 96.024 N N N N
vg0421568928 C -> T LOC_Os04g35430.1 upstream_gene_variant ; 2940.0bp to feature; MODIFIER silent_mutation Average:61.979; most accessible tissue: Callus, score: 96.024 N N N N
vg0421568928 C -> T LOC_Os04g35440.1 upstream_gene_variant ; 1389.0bp to feature; MODIFIER silent_mutation Average:61.979; most accessible tissue: Callus, score: 96.024 N N N N
vg0421568928 C -> T LOC_Os04g35430-LOC_Os04g35440 intergenic_region ; MODIFIER silent_mutation Average:61.979; most accessible tissue: Callus, score: 96.024 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0421568928 C T -0.04 -0.03 -0.02 0.02 -0.01 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0421568928 NA 1.12E-07 mr1078 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421568928 NA 8.35E-08 mr1133 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421568928 NA 9.20E-08 mr1536 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421568928 NA 4.06E-06 mr1667 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421568928 NA 8.20E-12 mr1914 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421568928 NA 1.79E-08 mr1946 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421568928 NA 3.62E-06 mr1133_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421568928 NA 3.15E-12 mr1172_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421568928 NA 1.13E-07 mr1212_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421568928 NA 8.40E-06 mr1428_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421568928 NA 2.31E-08 mr1449_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421568928 NA 2.67E-08 mr1536_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421568928 9.86E-07 NA mr1610_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421568928 1.45E-06 9.86E-07 mr1610_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421568928 NA 8.27E-06 mr1667_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421568928 NA 8.46E-06 mr1897_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421568928 NA 7.09E-06 mr1914_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421568928 NA 2.68E-06 mr1927_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251