Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0421559077:

Variant ID: vg0421559077 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 21559077
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:

TAAATATTAAACGTAGACTATTAATAAAACACATCCATAATTTTGGACTAATTCGCGAGACGAATCTATTGAGCCTAATTATTCCATGATTAGCCTATGT[G/A]
ATACTACAGTAAACATTCTCTAATTATAGATTAATTATGCTTAAAAATTTTGTCTCGCAAATTAGCTTTAATTTATGTAATTAGTTTTGTAAGTAGTTTA

Reverse complement sequence

TAAACTACTTACAAAACTAATTACATAAATTAAAGCTAATTTGCGAGACAAAATTTTTAAGCATAATTAATCTATAATTAGAGAATGTTTACTGTAGTAT[C/T]
ACATAGGCTAATCATGGAATAATTAGGCTCAATAGATTCGTCTCGCGAATTAGTCCAAAATTATGGATGTGTTTTATTAATAGTCTACGTTTAATATTTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	74.90%	21.90%	1.54%	1.65%	NA
All Indica	2759	59.90%	34.70%	2.57%	2.79%	NA
All Japonica	1512	96.90%	3.10%	0.00%	0.00%	NA
Aus	269	96.30%	3.70%	0.00%	0.00%	NA
Indica I	595	81.50%	13.40%	3.03%	2.02%	NA
Indica II	465	68.60%	26.20%	3.66%	1.51%	NA
Indica III	913	39.90%	53.50%	2.30%	4.38%	NA
Indica Intermediate	786	61.80%	34.00%	1.91%	2.29%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	91.70%	8.30%	0.00%	0.00%	NA
Japonica Intermediate	241	98.30%	1.70%	0.00%	0.00%	NA
VI/Aromatic	96	87.50%	11.50%	1.04%	0.00%	NA
Intermediate	90	85.60%	12.20%	1.11%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0421559077	G -> DEL	N	N	silent_mutation	Average:42.196; most accessible tissue: Zhenshan97 panicle, score: 74.671	N	N	N	N
vg0421559077	G -> A	LOC_Os04g35420.1	upstream_gene_variant ; 762.0bp to feature; MODIFIER	silent_mutation	Average:42.196; most accessible tissue: Zhenshan97 panicle, score: 74.671	N	N	N	N
vg0421559077	G -> A	LOC_Os04g35430.1	downstream_gene_variant ; 152.0bp to feature; MODIFIER	silent_mutation	Average:42.196; most accessible tissue: Zhenshan97 panicle, score: 74.671	N	N	N	N
vg0421559077	G -> A	LOC_Os04g35420-LOC_Os04g35430	intergenic_region ; MODIFIER	silent_mutation	Average:42.196; most accessible tissue: Zhenshan97 panicle, score: 74.671	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0421559077	NA	4.06E-06	mr1262_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421559077	5.74E-06	NA	mr1304_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421559077	5.09E-06	NA	mr1661_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421559077	NA	5.12E-06	mr1869_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421559077	9.39E-06	4.86E-09	mr1940_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251