\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0421509835:

Variant ID: vg0421509835 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 21509835
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, C: 0.02, others allele: 0.00, population size: 47. )

Flanking Sequence (100 bp) in Reference Genome:


AATTGATTCGTCTCGCAGTTTACAGGTAGAATCTGTAATTTGTTTTGTTATTAGTCTATGTTTAATACTTTAAATGTGTGTTCATATACTTAAAAAAAAT[T/C]
GAAAAGGAGCTAAACAAATGGTAATTATATCTAACTAAGCAAATATGTGGGCACCGGCCTATCCGCTAGTAGTTACTAGTTAGTATAAAAACAAAACGAT

Reverse complement sequence

ATCGTTTTGTTTTTATACTAACTAGTAACTACTAGCGGATAGGCCGGTGCCCACATATTTGCTTAGTTAGATATAATTACCATTTGTTTAGCTCCTTTTC[A/G]
ATTTTTTTTAAGTATATGAACACACATTTAAAGTATTAAACATAGACTAATAACAAAACAAATTACAGATTCTACCTGTAAACTGCGAGACGAATCAATT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.40% 16.20% 1.35% 3.07% NA
All Indica  2759 67.80% 26.00% 2.17% 4.06% NA
All Japonica  1512 99.90% 0.10% 0.07% 0.00% NA
Aus  269 73.60% 13.40% 0.74% 12.27% NA
Indica I  595 75.60% 16.10% 4.71% 3.53% NA
Indica II  465 72.50% 22.40% 3.01% 2.15% NA
Indica III  913 56.20% 37.50% 0.22% 6.13% NA
Indica Intermediate  786 72.50% 22.30% 2.04% 3.18% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.41% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 92.20% 6.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0421509835 T -> C LOC_Os04g35370.1 upstream_gene_variant ; 1028.0bp to feature; MODIFIER silent_mutation Average:45.782; most accessible tissue: Zhenshan97 root, score: 57.64 N N N N
vg0421509835 T -> C LOC_Os04g35380.1 upstream_gene_variant ; 3634.0bp to feature; MODIFIER silent_mutation Average:45.782; most accessible tissue: Zhenshan97 root, score: 57.64 N N N N
vg0421509835 T -> C LOC_Os04g35380.4 upstream_gene_variant ; 3634.0bp to feature; MODIFIER silent_mutation Average:45.782; most accessible tissue: Zhenshan97 root, score: 57.64 N N N N
vg0421509835 T -> C LOC_Os04g35380.2 upstream_gene_variant ; 3634.0bp to feature; MODIFIER silent_mutation Average:45.782; most accessible tissue: Zhenshan97 root, score: 57.64 N N N N
vg0421509835 T -> C LOC_Os04g35380.5 upstream_gene_variant ; 3634.0bp to feature; MODIFIER silent_mutation Average:45.782; most accessible tissue: Zhenshan97 root, score: 57.64 N N N N
vg0421509835 T -> C LOC_Os04g35370-LOC_Os04g35380 intergenic_region ; MODIFIER silent_mutation Average:45.782; most accessible tissue: Zhenshan97 root, score: 57.64 N N N N
vg0421509835 T -> DEL N N silent_mutation Average:45.782; most accessible tissue: Zhenshan97 root, score: 57.64 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0421509835 NA 5.22E-07 mr1317_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421509835 2.59E-06 NA mr1610_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421509835 NA 4.27E-07 mr1610_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421509835 NA 3.97E-06 mr1818_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421509835 5.69E-06 NA mr1897_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421509835 5.19E-07 4.39E-07 mr1897_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251