Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0421509835:

Variant ID: vg0421509835 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 21509835
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, C: 0.02, others allele: 0.00, population size: 47. )

Flanking Sequence (100 bp) in Reference Genome:

AATTGATTCGTCTCGCAGTTTACAGGTAGAATCTGTAATTTGTTTTGTTATTAGTCTATGTTTAATACTTTAAATGTGTGTTCATATACTTAAAAAAAAT[T/C]
GAAAAGGAGCTAAACAAATGGTAATTATATCTAACTAAGCAAATATGTGGGCACCGGCCTATCCGCTAGTAGTTACTAGTTAGTATAAAAACAAAACGAT

Reverse complement sequence

ATCGTTTTGTTTTTATACTAACTAGTAACTACTAGCGGATAGGCCGGTGCCCACATATTTGCTTAGTTAGATATAATTACCATTTGTTTAGCTCCTTTTC[A/G]
ATTTTTTTTAAGTATATGAACACACATTTAAAGTATTAAACATAGACTAATAACAAAACAAATTACAGATTCTACCTGTAAACTGCGAGACGAATCAATT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	79.40%	16.20%	1.35%	3.07%	NA
All Indica	2759	67.80%	26.00%	2.17%	4.06%	NA
All Japonica	1512	99.90%	0.10%	0.07%	0.00%	NA
Aus	269	73.60%	13.40%	0.74%	12.27%	NA
Indica I	595	75.60%	16.10%	4.71%	3.53%	NA
Indica II	465	72.50%	22.40%	3.01%	2.15%	NA
Indica III	913	56.20%	37.50%	0.22%	6.13%	NA
Indica Intermediate	786	72.50%	22.30%	2.04%	3.18%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.00%	0.41%	0.00%	NA
VI/Aromatic	96	95.80%	4.20%	0.00%	0.00%	NA
Intermediate	90	92.20%	6.70%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0421509835	T -> C	LOC_Os04g35370.1	upstream_gene_variant ; 1028.0bp to feature; MODIFIER	silent_mutation	Average:45.782; most accessible tissue: Zhenshan97 root, score: 57.64	N	N	N	N
vg0421509835	T -> C	LOC_Os04g35380.1	upstream_gene_variant ; 3634.0bp to feature; MODIFIER	silent_mutation	Average:45.782; most accessible tissue: Zhenshan97 root, score: 57.64	N	N	N	N
vg0421509835	T -> C	LOC_Os04g35380.4	upstream_gene_variant ; 3634.0bp to feature; MODIFIER	silent_mutation	Average:45.782; most accessible tissue: Zhenshan97 root, score: 57.64	N	N	N	N
vg0421509835	T -> C	LOC_Os04g35380.2	upstream_gene_variant ; 3634.0bp to feature; MODIFIER	silent_mutation	Average:45.782; most accessible tissue: Zhenshan97 root, score: 57.64	N	N	N	N
vg0421509835	T -> C	LOC_Os04g35380.5	upstream_gene_variant ; 3634.0bp to feature; MODIFIER	silent_mutation	Average:45.782; most accessible tissue: Zhenshan97 root, score: 57.64	N	N	N	N
vg0421509835	T -> C	LOC_Os04g35370-LOC_Os04g35380	intergenic_region ; MODIFIER	silent_mutation	Average:45.782; most accessible tissue: Zhenshan97 root, score: 57.64	N	N	N	N
vg0421509835	T -> DEL	N	N	silent_mutation	Average:45.782; most accessible tissue: Zhenshan97 root, score: 57.64	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0421509835	NA	5.22E-07	mr1317_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421509835	2.59E-06	NA	mr1610_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421509835	NA	4.27E-07	mr1610_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421509835	NA	3.97E-06	mr1818_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421509835	5.69E-06	NA	mr1897_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421509835	5.19E-07	4.39E-07	mr1897_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251