Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0421498214:

Variant ID: vg0421498214 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 21498214
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.56, T: 0.43, others allele: 0.00, population size: 72. )

Flanking Sequence (100 bp) in Reference Genome:

ACCGCCGTTTGGGATCGCGTCCCTGACGCGGGAGTAGCCCTCCGTCTTGAGCAGGTGCTGCCCGCTCTCGGTGCCGGCAACGACGGCGGAGGCTGACCGC[A/T]
GAGGTGGCCTACGGCTGCCGCCGGTGGTGGACATGGCCTGGCCGGAGTCGATCGTTCTCTGTTCGTTCACTGAATGTACCTGGGAAAATTGGCAGATTGT

Reverse complement sequence

ACAATCTGCCAATTTTCCCAGGTACATTCAGTGAACGAACAGAGAACGATCGACTCCGGCCAGGCCATGTCCACCACCGGCGGCAGCCGTAGGCCACCTC[T/A]
GCGGTCAGCCTCCGCCGTCGTTGCCGGCACCGAGAGCGGGCAGCACCTGCTCAAGACGGAGGGCTACTCCCGCGTCAGGGACGCGATCCCAAACGGCGGT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	56.10%	40.60%	0.47%	2.88%	NA
All Indica	2759	53.60%	41.90%	0.33%	4.17%	NA
All Japonica	1512	64.70%	35.20%	0.13%	0.00%	NA
Aus	269	22.30%	65.80%	4.09%	7.81%	NA
Indica I	595	80.50%	19.30%	0.17%	0.00%	NA
Indica II	465	72.50%	27.10%	0.00%	0.43%	NA
Indica III	913	30.70%	61.30%	0.55%	7.45%	NA
Indica Intermediate	786	48.70%	45.20%	0.38%	5.73%	NA
Temperate Japonica	767	77.20%	22.60%	0.26%	0.00%	NA
Tropical Japonica	504	35.10%	64.90%	0.00%	0.00%	NA
Japonica Intermediate	241	86.70%	13.30%	0.00%	0.00%	NA
VI/Aromatic	96	83.30%	16.70%	0.00%	0.00%	NA
Intermediate	90	60.00%	40.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0421498214	A -> DEL	N	N	silent_mutation	Average:64.874; most accessible tissue: Callus, score: 89.113	N	N	N	N
vg0421498214	A -> T	LOC_Os04g35340.1	upstream_gene_variant ; 3972.0bp to feature; MODIFIER	silent_mutation	Average:64.874; most accessible tissue: Callus, score: 89.113	N	N	N	N
vg0421498214	A -> T	LOC_Os04g35340-LOC_Os04g35370	intergenic_region ; MODIFIER	silent_mutation	Average:64.874; most accessible tissue: Callus, score: 89.113	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0421498214	4.90E-06	NA	mr1200_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421498214	6.76E-07	6.65E-07	mr1262_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421498214	4.10E-06	4.10E-06	mr1262_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421498214	2.67E-06	NA	mr1304_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421498214	6.23E-06	2.95E-06	mr1345_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421498214	5.49E-06	NA	mr1551_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421498214	NA	6.90E-06	mr1609_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421498214	NA	9.21E-08	mr1696_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421498214	NA	7.62E-07	mr1707_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421498214	NA	3.64E-07	mr1819_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421498214	3.06E-06	NA	mr1829_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251