\
| Variant ID: vg0421497707 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 21497707 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 107. )
ATGAAGCACACGGTCGTTAGTTAATGACAAATATCATTGTTTTTTTTATTCCTGGTTCTGATTCATTATTGGATCATGTTTCACCATTCAGAGTGTGTCC[C/T]
GTGGTGTTTTCTTTTCGTGCAGAACCATGTGGTTCATTTGTATTTTTGAGTCTTTCCTTAAGTGCATCTCTGTACGTTTACATGTTTTTTTTTTTGTCCC
GGGACAAAAAAAAAAACATGTAAACGTACAGAGATGCACTTAAGGAAAGACTCAAAAATACAAATGAACCACATGGTTCTGCACGAAAAGAAAACACCAC[G/A]
GGACACACTCTGAATGGTGAAACATGATCCAATAATGAATCAGAACCAGGAATAAAAAAAACAATGATATTTGTCATTAACTAACGACCGTGTGCTTCAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 49.20% | 0.80% | 14.71% | 35.27% | NA |
| All Indica | 2759 | 49.70% | 1.20% | 15.30% | 33.82% | NA |
| All Japonica | 1512 | 52.10% | 0.00% | 3.51% | 44.44% | NA |
| Aus | 269 | 29.70% | 1.10% | 58.74% | 10.41% | NA |
| Indica I | 595 | 78.70% | 0.30% | 6.05% | 14.96% | NA |
| Indica II | 465 | 71.60% | 1.70% | 5.38% | 21.29% | NA |
| Indica III | 913 | 21.90% | 1.50% | 23.44% | 53.12% | NA |
| Indica Intermediate | 786 | 46.90% | 1.30% | 18.70% | 33.08% | NA |
| Temperate Japonica | 767 | 75.10% | 0.00% | 1.96% | 22.95% | NA |
| Tropical Japonica | 504 | 20.20% | 0.00% | 5.56% | 74.21% | NA |
| Japonica Intermediate | 241 | 45.20% | 0.00% | 4.15% | 50.62% | NA |
| VI/Aromatic | 96 | 40.60% | 1.00% | 43.75% | 14.58% | NA |
| Intermediate | 90 | 53.30% | 2.20% | 22.22% | 22.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0421497707 | C -> DEL | N | N | silent_mutation | Average:36.308; most accessible tissue: Zhenshan97 flower, score: 76.539 | N | N | N | N |
| vg0421497707 | C -> T | LOC_Os04g35340.1 | upstream_gene_variant ; 3465.0bp to feature; MODIFIER | silent_mutation | Average:36.308; most accessible tissue: Zhenshan97 flower, score: 76.539 | N | N | N | N |
| vg0421497707 | C -> T | LOC_Os04g35340-LOC_Os04g35370 | intergenic_region ; MODIFIER | silent_mutation | Average:36.308; most accessible tissue: Zhenshan97 flower, score: 76.539 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0421497707 | NA | 3.22E-06 | mr1277 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421497707 | 8.89E-06 | NA | mr1200_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421497707 | 2.16E-06 | 2.16E-06 | mr1303_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421497707 | 6.60E-06 | NA | mr1304_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421497707 | 7.05E-06 | 7.05E-06 | mr1424_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421497707 | 2.37E-06 | NA | mr1551_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421497707 | 5.25E-06 | NA | mr1612_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421497707 | 5.76E-06 | NA | mr1757_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421497707 | NA | 3.48E-07 | mr1762_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421497707 | NA | 6.21E-06 | mr1790_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421497707 | 9.11E-07 | 5.10E-08 | mr1819_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |