\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0421477325:

Variant ID: vg0421477325 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 21477325
Reference Allele: AAlternative Allele: G,T
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, G: 0.02, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


TCCAACTTTTTCATCACATCGTTTCAATTTCAACCAGACTTCCAATTTTGACGTGAACTAAATACAGTTCACGCCAAAATTAGAAGTCTGGTTGAAATTG[A/G,T]
AATGATGTGACGTAAAAGTTGAAAATTTGTGTGTGTAAGAAAGTTCTGATGTGATGGAAAAGTTGAAAGTTTGAAGAAAAAGTTTAGAACTAAACTCGGC

Reverse complement sequence

GCCGAGTTTAGTTCTAAACTTTTTCTTCAAACTTTCAACTTTTCCATCACATCAGAACTTTCTTACACACACAAATTTTCAACTTTTACGTCACATCATT[T/C,A]
CAATTTCAACCAGACTTCTAATTTTGGCGTGAACTGTATTTAGTTCACGTCAAAATTGGAAGTCTGGTTGAAATTGAAACGATGTGATGAAAAAGTTGGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.90% 9.60% 0.17% 0.00% T: 0.34%
All Indica  2759 89.30% 9.90% 0.18% 0.00% T: 0.58%
All Japonica  1512 97.00% 3.00% 0.07% 0.00% NA
Aus  269 66.20% 33.10% 0.74% 0.00% NA
Indica I  595 90.80% 9.20% 0.00% 0.00% NA
Indica II  465 97.20% 1.10% 0.43% 0.00% T: 1.29%
Indica III  913 82.90% 15.90% 0.33% 0.00% T: 0.88%
Indica Intermediate  786 91.10% 8.70% 0.00% 0.00% T: 0.25%
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 92.30% 7.70% 0.00% 0.00% NA
Japonica Intermediate  241 97.10% 2.50% 0.41% 0.00% NA
VI/Aromatic  96 56.20% 43.80% 0.00% 0.00% NA
Intermediate  90 94.40% 5.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0421477325 A -> G LOC_Os04g35310.1 upstream_gene_variant ; 2872.0bp to feature; MODIFIER silent_mutation Average:39.764; most accessible tissue: Callus, score: 79.61 N N N N
vg0421477325 A -> G LOC_Os04g35320.1 upstream_gene_variant ; 2837.0bp to feature; MODIFIER silent_mutation Average:39.764; most accessible tissue: Callus, score: 79.61 N N N N
vg0421477325 A -> G LOC_Os04g35310-LOC_Os04g35320 intergenic_region ; MODIFIER silent_mutation Average:39.764; most accessible tissue: Callus, score: 79.61 N N N N
vg0421477325 A -> T LOC_Os04g35310.1 upstream_gene_variant ; 2872.0bp to feature; MODIFIER silent_mutation Average:39.764; most accessible tissue: Callus, score: 79.61 N N N N
vg0421477325 A -> T LOC_Os04g35320.1 upstream_gene_variant ; 2837.0bp to feature; MODIFIER silent_mutation Average:39.764; most accessible tissue: Callus, score: 79.61 N N N N
vg0421477325 A -> T LOC_Os04g35310-LOC_Os04g35320 intergenic_region ; MODIFIER silent_mutation Average:39.764; most accessible tissue: Callus, score: 79.61 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0421477325 8.89E-07 NA mr1004 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421477325 7.96E-07 NA mr1005 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421477325 NA 4.92E-08 mr1094 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421477325 NA 5.10E-08 mr1096 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421477325 NA 8.93E-07 mr1121 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421477325 NA 1.51E-06 mr1155 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421477325 NA 1.89E-07 mr1213 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421477325 NA 2.57E-06 mr1705 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251