\
| Variant ID: vg0421477325 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 21477325 |
| Reference Allele: A | Alternative Allele: G,T |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, G: 0.02, others allele: 0.00, population size: 113. )
TCCAACTTTTTCATCACATCGTTTCAATTTCAACCAGACTTCCAATTTTGACGTGAACTAAATACAGTTCACGCCAAAATTAGAAGTCTGGTTGAAATTG[A/G,T]
AATGATGTGACGTAAAAGTTGAAAATTTGTGTGTGTAAGAAAGTTCTGATGTGATGGAAAAGTTGAAAGTTTGAAGAAAAAGTTTAGAACTAAACTCGGC
GCCGAGTTTAGTTCTAAACTTTTTCTTCAAACTTTCAACTTTTCCATCACATCAGAACTTTCTTACACACACAAATTTTCAACTTTTACGTCACATCATT[T/C,A]
CAATTTCAACCAGACTTCTAATTTTGGCGTGAACTGTATTTAGTTCACGTCAAAATTGGAAGTCTGGTTGAAATTGAAACGATGTGATGAAAAAGTTGGA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.90% | 9.60% | 0.17% | 0.00% | T: 0.34% |
| All Indica | 2759 | 89.30% | 9.90% | 0.18% | 0.00% | T: 0.58% |
| All Japonica | 1512 | 97.00% | 3.00% | 0.07% | 0.00% | NA |
| Aus | 269 | 66.20% | 33.10% | 0.74% | 0.00% | NA |
| Indica I | 595 | 90.80% | 9.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.20% | 1.10% | 0.43% | 0.00% | T: 1.29% |
| Indica III | 913 | 82.90% | 15.90% | 0.33% | 0.00% | T: 0.88% |
| Indica Intermediate | 786 | 91.10% | 8.70% | 0.00% | 0.00% | T: 0.25% |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 92.30% | 7.70% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.10% | 2.50% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 56.20% | 43.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0421477325 | A -> G | LOC_Os04g35310.1 | upstream_gene_variant ; 2872.0bp to feature; MODIFIER | silent_mutation | Average:39.764; most accessible tissue: Callus, score: 79.61 | N | N | N | N |
| vg0421477325 | A -> G | LOC_Os04g35320.1 | upstream_gene_variant ; 2837.0bp to feature; MODIFIER | silent_mutation | Average:39.764; most accessible tissue: Callus, score: 79.61 | N | N | N | N |
| vg0421477325 | A -> G | LOC_Os04g35310-LOC_Os04g35320 | intergenic_region ; MODIFIER | silent_mutation | Average:39.764; most accessible tissue: Callus, score: 79.61 | N | N | N | N |
| vg0421477325 | A -> T | LOC_Os04g35310.1 | upstream_gene_variant ; 2872.0bp to feature; MODIFIER | silent_mutation | Average:39.764; most accessible tissue: Callus, score: 79.61 | N | N | N | N |
| vg0421477325 | A -> T | LOC_Os04g35320.1 | upstream_gene_variant ; 2837.0bp to feature; MODIFIER | silent_mutation | Average:39.764; most accessible tissue: Callus, score: 79.61 | N | N | N | N |
| vg0421477325 | A -> T | LOC_Os04g35310-LOC_Os04g35320 | intergenic_region ; MODIFIER | silent_mutation | Average:39.764; most accessible tissue: Callus, score: 79.61 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0421477325 | 8.89E-07 | NA | mr1004 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421477325 | 7.96E-07 | NA | mr1005 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421477325 | NA | 4.92E-08 | mr1094 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421477325 | NA | 5.10E-08 | mr1096 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421477325 | NA | 8.93E-07 | mr1121 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421477325 | NA | 1.51E-06 | mr1155 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421477325 | NA | 1.89E-07 | mr1213 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421477325 | NA | 2.57E-06 | mr1705 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |