\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0421477298:

Variant ID: vg0421477298 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 21477298
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:


ATTAAAACTTTTCTATATACACAAACTTCCAACTTTTTCATCACATCGTTTCAATTTCAACCAGACTTCCAATTTTGACGTGAACTAAATACAGTTCACG[C/T]
CAAAATTAGAAGTCTGGTTGAAATTGAAATGATGTGACGTAAAAGTTGAAAATTTGTGTGTGTAAGAAAGTTCTGATGTGATGGAAAAGTTGAAAGTTTG

Reverse complement sequence

CAAACTTTCAACTTTTCCATCACATCAGAACTTTCTTACACACACAAATTTTCAACTTTTACGTCACATCATTTCAATTTCAACCAGACTTCTAATTTTG[G/A]
CGTGAACTGTATTTAGTTCACGTCAAAATTGGAAGTCTGGTTGAAATTGAAACGATGTGATGAAAAAGTTGGAAGTTTGTGTATATAGAAAAGTTTTAAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.90% 28.90% 0.17% 0.00% NA
All Indica  2759 56.90% 42.80% 0.25% 0.00% NA
All Japonica  1512 96.70% 3.20% 0.07% 0.00% NA
Aus  269 69.90% 30.10% 0.00% 0.00% NA
Indica I  595 70.90% 28.90% 0.17% 0.00% NA
Indica II  465 74.00% 25.80% 0.22% 0.00% NA
Indica III  913 38.00% 61.80% 0.22% 0.00% NA
Indica Intermediate  786 58.10% 41.50% 0.38% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 91.90% 8.10% 0.00% 0.00% NA
Japonica Intermediate  241 96.70% 2.90% 0.41% 0.00% NA
VI/Aromatic  96 56.20% 43.80% 0.00% 0.00% NA
Intermediate  90 86.70% 13.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0421477298 C -> T LOC_Os04g35310.1 upstream_gene_variant ; 2845.0bp to feature; MODIFIER silent_mutation Average:40.152; most accessible tissue: Callus, score: 79.61 N N N N
vg0421477298 C -> T LOC_Os04g35320.1 upstream_gene_variant ; 2864.0bp to feature; MODIFIER silent_mutation Average:40.152; most accessible tissue: Callus, score: 79.61 N N N N
vg0421477298 C -> T LOC_Os04g35310-LOC_Os04g35320 intergenic_region ; MODIFIER silent_mutation Average:40.152; most accessible tissue: Callus, score: 79.61 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0421477298 3.18E-07 NA mr1068 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421477298 3.71E-06 3.01E-09 mr1078 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421477298 5.28E-06 NA mr1087 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421477298 9.40E-06 NA mr1090 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421477298 1.39E-07 NA mr1090 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421477298 NA 3.34E-07 mr1094 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421477298 5.89E-06 3.89E-07 mr1111 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421477298 5.80E-06 2.08E-07 mr1144 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421477298 5.77E-06 NA mr1211 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421477298 1.61E-06 NA mr1211 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421477298 NA 1.36E-07 mr1078_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421477298 NA 6.50E-07 mr1094_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421477298 NA 2.95E-07 mr1144_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251