\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0421459150:

Variant ID: vg0421459150 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 21459150
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:


AACACATATATGAAAATTTTATTCACAAATTATTTTTTATTTGTAAATATGTTGTTTCACTTTTTCCTCCAATATATCAAACGATGAGGCTGTTTGAAGC[A/G]
TATGTACATCTACTGTATATTACGTGAACACGAAGCAAGAAACAATTATACAGTGTCTCTCAAATAATTTGGTTGGATAACTTGTGCGTTTGATTAACTG

Reverse complement sequence

CAGTTAATCAAACGCACAAGTTATCCAACCAAATTATTTGAGAGACACTGTATAATTGTTTCTTGCTTCGTGTTCACGTAATATACAGTAGATGTACATA[T/C]
GCTTCAAACAGCCTCATCGTTTGATATATTGGAGGAAAAAGTGAAACAACATATTTACAAATAAAAAATAATTTGTGAATAAAATTTTCATATATGTGTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.20% 34.60% 0.25% 0.00% NA
All Indica  2759 69.80% 30.20% 0.07% 0.00% NA
All Japonica  1512 51.10% 48.50% 0.46% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 46.60% 53.40% 0.00% 0.00% NA
Indica II  465 34.60% 65.40% 0.00% 0.00% NA
Indica III  913 98.70% 1.30% 0.00% 0.00% NA
Indica Intermediate  786 74.60% 25.20% 0.25% 0.00% NA
Temperate Japonica  767 27.40% 71.80% 0.78% 0.00% NA
Tropical Japonica  504 80.80% 19.00% 0.20% 0.00% NA
Japonica Intermediate  241 64.30% 35.70% 0.00% 0.00% NA
VI/Aromatic  96 66.70% 33.30% 0.00% 0.00% NA
Intermediate  90 57.80% 38.90% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0421459150 A -> G LOC_Os04g35280.1 upstream_gene_variant ; 3110.0bp to feature; MODIFIER silent_mutation Average:44.389; most accessible tissue: Minghui63 young leaf, score: 84.144 N N N N
vg0421459150 A -> G LOC_Os04g35290.1 downstream_gene_variant ; 2883.0bp to feature; MODIFIER silent_mutation Average:44.389; most accessible tissue: Minghui63 young leaf, score: 84.144 N N N N
vg0421459150 A -> G LOC_Os04g35280-LOC_Os04g35290 intergenic_region ; MODIFIER silent_mutation Average:44.389; most accessible tissue: Minghui63 young leaf, score: 84.144 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0421459150 A G -0.02 0.01 0.01 0.0 0.0 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0421459150 NA 1.34E-07 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421459150 NA 1.45E-09 mr1065 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421459150 NA 3.74E-10 mr1078 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421459150 NA 2.99E-11 mr1091 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421459150 NA 7.44E-09 mr1094 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421459150 NA 7.15E-09 mr1096 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421459150 NA 6.42E-10 mr1108 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421459150 NA 4.07E-09 mr1110 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421459150 NA 2.00E-06 mr1111 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421459150 NA 2.85E-09 mr1112 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421459150 NA 5.76E-06 mr1121 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421459150 NA 5.95E-11 mr1133 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421459150 NA 5.13E-07 mr1144 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421459150 NA 3.72E-09 mr1234 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421459150 NA 3.21E-06 mr1526 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421459150 NA 1.10E-08 mr1667 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421459150 NA 4.84E-08 mr1877 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421459150 NA 9.24E-12 mr1091_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421459150 NA 8.14E-08 mr1094_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421459150 NA 2.13E-06 mr1096_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421459150 NA 1.84E-07 mr1110_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421459150 NA 1.33E-08 mr1112_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421459150 NA 4.11E-07 mr1133_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421459150 NA 9.56E-07 mr1346_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421459150 NA 9.57E-06 mr1428_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421459150 1.56E-06 1.56E-06 mr1474_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421459150 NA 7.65E-06 mr1657_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421459150 NA 4.18E-06 mr1667_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251