\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0421446950:

Variant ID: vg0421446950 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 21446950
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTACAAGATTCGTTCCGGTGAAGAAGAAAAAAATCACAGCACACACATATGTGAAAAGATTTGTTCCTAGGACCTCTATTTTACTGAAATAACATGTTAC[C/T]
GAGATATTCTTGAAAGTTACATACAAATTACATTATAGTTACAGTGTAATTACATGTAAGTTACAGTGTAATTATACTACGATTGTACTGTAATTACATC

Reverse complement sequence

GATGTAATTACAGTACAATCGTAGTATAATTACACTGTAACTTACATGTAATTACACTGTAACTATAATGTAATTTGTATGTAACTTTCAAGAATATCTC[G/A]
GTAACATGTTATTTCAGTAAAATAGAGGTCCTAGGAACAAATCTTTTCACATATGTGTGTGCTGTGATTTTTTTCTTCTTCACCGGAACGAATCTTGTAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.80% 8.50% 0.32% 6.43% NA
All Indica  2759 75.30% 14.20% 0.36% 10.18% NA
All Japonica  1512 99.80% 0.20% 0.00% 0.00% NA
Aus  269 89.20% 0.70% 1.86% 8.18% NA
Indica I  595 75.60% 15.10% 0.17% 9.08% NA
Indica II  465 90.80% 4.30% 0.22% 4.73% NA
Indica III  913 65.10% 20.90% 0.33% 13.69% NA
Indica Intermediate  786 77.70% 11.50% 0.64% 10.18% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 93.30% 5.60% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0421446950 C -> DEL N N silent_mutation Average:36.154; most accessible tissue: Minghui63 root, score: 65.927 N N N N
vg0421446950 C -> T LOC_Os04g35260.1 upstream_gene_variant ; 1528.0bp to feature; MODIFIER silent_mutation Average:36.154; most accessible tissue: Minghui63 root, score: 65.927 N N N N
vg0421446950 C -> T LOC_Os04g35270.1 upstream_gene_variant ; 946.0bp to feature; MODIFIER silent_mutation Average:36.154; most accessible tissue: Minghui63 root, score: 65.927 N N N N
vg0421446950 C -> T LOC_Os04g35280.1 downstream_gene_variant ; 4543.0bp to feature; MODIFIER silent_mutation Average:36.154; most accessible tissue: Minghui63 root, score: 65.927 N N N N
vg0421446950 C -> T LOC_Os04g35260-LOC_Os04g35270 intergenic_region ; MODIFIER silent_mutation Average:36.154; most accessible tissue: Minghui63 root, score: 65.927 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0421446950 NA 7.49E-06 mr1037 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421446950 4.91E-06 8.45E-08 mr1192 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421446950 6.54E-06 5.31E-08 mr1192 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421446950 NA 4.79E-12 mr1739_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421446950 NA 6.05E-09 mr1739_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251