| Variant ID: vg0421446950 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 21446950 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TTACAAGATTCGTTCCGGTGAAGAAGAAAAAAATCACAGCACACACATATGTGAAAAGATTTGTTCCTAGGACCTCTATTTTACTGAAATAACATGTTAC[C/T]
GAGATATTCTTGAAAGTTACATACAAATTACATTATAGTTACAGTGTAATTACATGTAAGTTACAGTGTAATTATACTACGATTGTACTGTAATTACATC
GATGTAATTACAGTACAATCGTAGTATAATTACACTGTAACTTACATGTAATTACACTGTAACTATAATGTAATTTGTATGTAACTTTCAAGAATATCTC[G/A]
GTAACATGTTATTTCAGTAAAATAGAGGTCCTAGGAACAAATCTTTTCACATATGTGTGTGCTGTGATTTTTTTCTTCTTCACCGGAACGAATCTTGTAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 84.80% | 8.50% | 0.32% | 6.43% | NA |
| All Indica | 2759 | 75.30% | 14.20% | 0.36% | 10.18% | NA |
| All Japonica | 1512 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 89.20% | 0.70% | 1.86% | 8.18% | NA |
| Indica I | 595 | 75.60% | 15.10% | 0.17% | 9.08% | NA |
| Indica II | 465 | 90.80% | 4.30% | 0.22% | 4.73% | NA |
| Indica III | 913 | 65.10% | 20.90% | 0.33% | 13.69% | NA |
| Indica Intermediate | 786 | 77.70% | 11.50% | 0.64% | 10.18% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 5.60% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0421446950 | C -> DEL | N | N | silent_mutation | Average:36.154; most accessible tissue: Minghui63 root, score: 65.927 | N | N | N | N |
| vg0421446950 | C -> T | LOC_Os04g35260.1 | upstream_gene_variant ; 1528.0bp to feature; MODIFIER | silent_mutation | Average:36.154; most accessible tissue: Minghui63 root, score: 65.927 | N | N | N | N |
| vg0421446950 | C -> T | LOC_Os04g35270.1 | upstream_gene_variant ; 946.0bp to feature; MODIFIER | silent_mutation | Average:36.154; most accessible tissue: Minghui63 root, score: 65.927 | N | N | N | N |
| vg0421446950 | C -> T | LOC_Os04g35280.1 | downstream_gene_variant ; 4543.0bp to feature; MODIFIER | silent_mutation | Average:36.154; most accessible tissue: Minghui63 root, score: 65.927 | N | N | N | N |
| vg0421446950 | C -> T | LOC_Os04g35260-LOC_Os04g35270 | intergenic_region ; MODIFIER | silent_mutation | Average:36.154; most accessible tissue: Minghui63 root, score: 65.927 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0421446950 | NA | 7.49E-06 | mr1037 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421446950 | 4.91E-06 | 8.45E-08 | mr1192 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421446950 | 6.54E-06 | 5.31E-08 | mr1192 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421446950 | NA | 4.79E-12 | mr1739_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421446950 | NA | 6.05E-09 | mr1739_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |