Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0421446950:

Variant ID: vg0421446950 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 21446950
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTACAAGATTCGTTCCGGTGAAGAAGAAAAAAATCACAGCACACACATATGTGAAAAGATTTGTTCCTAGGACCTCTATTTTACTGAAATAACATGTTAC[C/T]
GAGATATTCTTGAAAGTTACATACAAATTACATTATAGTTACAGTGTAATTACATGTAAGTTACAGTGTAATTATACTACGATTGTACTGTAATTACATC

Reverse complement sequence

GATGTAATTACAGTACAATCGTAGTATAATTACACTGTAACTTACATGTAATTACACTGTAACTATAATGTAATTTGTATGTAACTTTCAAGAATATCTC[G/A]
GTAACATGTTATTTCAGTAAAATAGAGGTCCTAGGAACAAATCTTTTCACATATGTGTGTGCTGTGATTTTTTTCTTCTTCACCGGAACGAATCTTGTAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	84.80%	8.50%	0.32%	6.43%	NA
All Indica	2759	75.30%	14.20%	0.36%	10.18%	NA
All Japonica	1512	99.80%	0.20%	0.00%	0.00%	NA
Aus	269	89.20%	0.70%	1.86%	8.18%	NA
Indica I	595	75.60%	15.10%	0.17%	9.08%	NA
Indica II	465	90.80%	4.30%	0.22%	4.73%	NA
Indica III	913	65.10%	20.90%	0.33%	13.69%	NA
Indica Intermediate	786	77.70%	11.50%	0.64%	10.18%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	99.60%	0.40%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	93.30%	5.60%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0421446950	C -> DEL	N	N	silent_mutation	Average:36.154; most accessible tissue: Minghui63 root, score: 65.927	N	N	N	N
vg0421446950	C -> T	LOC_Os04g35260.1	upstream_gene_variant ; 1528.0bp to feature; MODIFIER	silent_mutation	Average:36.154; most accessible tissue: Minghui63 root, score: 65.927	N	N	N	N
vg0421446950	C -> T	LOC_Os04g35270.1	upstream_gene_variant ; 946.0bp to feature; MODIFIER	silent_mutation	Average:36.154; most accessible tissue: Minghui63 root, score: 65.927	N	N	N	N
vg0421446950	C -> T	LOC_Os04g35280.1	downstream_gene_variant ; 4543.0bp to feature; MODIFIER	silent_mutation	Average:36.154; most accessible tissue: Minghui63 root, score: 65.927	N	N	N	N
vg0421446950	C -> T	LOC_Os04g35260-LOC_Os04g35270	intergenic_region ; MODIFIER	silent_mutation	Average:36.154; most accessible tissue: Minghui63 root, score: 65.927	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0421446950	NA	7.49E-06	mr1037	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421446950	4.91E-06	8.45E-08	mr1192	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421446950	6.54E-06	5.31E-08	mr1192	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421446950	NA	4.79E-12	mr1739_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421446950	NA	6.05E-09	mr1739_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251