\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0421446404:

Variant ID: vg0421446404 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 21446404
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.66, C: 0.33, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


TTGTGGTAAAGGGTAAGTGGCTTCAATCCCGAGATCCCATGTTCAATTCTCAACACGCTTATAATTTATTCTTGAAAAATGTTTGGATGGATGTCTCTCT[T/C]
CAAATCTTTCTTTTCTGTAAACACATAATCCACATATTCTTCTTCACATGGAGTAATAAACTAAAAGTACCAAGGCTTTGTTCGGCACATTGAGTTAGGA

Reverse complement sequence

TCCTAACTCAATGTGCCGAACAAAGCCTTGGTACTTTTAGTTTATTACTCCATGTGAAGAAGAATATGTGGATTATGTGTTTACAGAAAAGAAAGATTTG[A/G]
AGAGAGACATCCATCCAAACATTTTTCAAGAATAAATTATAAGCGTGTTGAGAATTGAACATGGGATCTCGGGATTGAAGCCACTTACCCTTTACCACAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.00% 37.80% 4.72% 2.43% NA
All Indica  2759 36.10% 59.10% 3.26% 1.56% NA
All Japonica  1512 89.70% 0.30% 6.81% 3.24% NA
Aus  269 49.80% 48.00% 2.23% 0.00% NA
Indica I  595 53.30% 45.90% 0.34% 0.50% NA
Indica II  465 69.90% 29.70% 0.22% 0.22% NA
Indica III  913 10.40% 81.40% 5.70% 2.52% NA
Indica Intermediate  786 32.80% 60.70% 4.45% 2.04% NA
Temperate Japonica  767 98.40% 0.00% 1.43% 0.13% NA
Tropical Japonica  504 88.50% 0.40% 5.36% 5.75% NA
Japonica Intermediate  241 64.30% 0.80% 26.97% 7.88% NA
VI/Aromatic  96 52.10% 7.30% 20.83% 19.79% NA
Intermediate  90 73.30% 17.80% 4.44% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0421446404 T -> C LOC_Os04g35260.1 upstream_gene_variant ; 982.0bp to feature; MODIFIER silent_mutation Average:59.778; most accessible tissue: Minghui63 root, score: 83.114 N N N N
vg0421446404 T -> C LOC_Os04g35270.1 upstream_gene_variant ; 1492.0bp to feature; MODIFIER silent_mutation Average:59.778; most accessible tissue: Minghui63 root, score: 83.114 N N N N
vg0421446404 T -> C LOC_Os04g35260-LOC_Os04g35270 intergenic_region ; MODIFIER silent_mutation Average:59.778; most accessible tissue: Minghui63 root, score: 83.114 N N N N
vg0421446404 T -> DEL N N silent_mutation Average:59.778; most accessible tissue: Minghui63 root, score: 83.114 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0421446404 NA 1.99E-06 mr1037 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421446404 NA 1.89E-10 mr1065 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421446404 NA 4.73E-08 mr1068 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421446404 1.26E-07 2.44E-12 mr1078 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421446404 NA 8.20E-12 mr1091 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421446404 NA 2.39E-09 mr1094 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421446404 NA 4.04E-09 mr1096 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421446404 NA 4.03E-10 mr1108 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421446404 NA 3.59E-10 mr1110 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421446404 NA 3.63E-08 mr1111 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421446404 NA 4.51E-10 mr1112 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421446404 NA 1.50E-06 mr1121 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421446404 NA 1.51E-06 mr1125 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421446404 NA 2.48E-23 mr1133 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421446404 NA 7.27E-13 mr1133 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421446404 NA 3.12E-08 mr1144 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421446404 NA 3.23E-10 mr1234 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421446404 NA 7.23E-07 mr1526 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421446404 NA 4.92E-12 mr1667 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421446404 NA 3.32E-08 mr1667 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421446404 NA 5.49E-09 mr1877 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421446404 NA 2.89E-08 mr1078_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421446404 NA 5.20E-12 mr1091_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421446404 NA 8.78E-09 mr1094_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421446404 NA 3.77E-07 mr1096_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421446404 NA 3.90E-08 mr1110_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421446404 NA 1.29E-08 mr1112_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421446404 NA 8.06E-06 mr1133_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421446404 NA 1.77E-06 mr1144_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421446404 NA 7.12E-08 mr1218_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421446404 NA 9.45E-06 mr1428_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251