\
| Variant ID: vg0421433477 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 21433477 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.85, T: 0.15, others allele: 0.00, population size: 101. )
ACCACGGCGGCAGCGCCTCTGGTGCCACAAAAAGAACTATTCCTGGAATAAGTTTTTCCAAGGGTCTCTTTGTAAAATAAGTTTTAGAAAAGGACCAAAT[C/T]
GTAAAAAATCTAGAAGGGTGGTTGGGGGTAAAATTAGTTGAAAATTAAATGAGGTGGTTGGTAAGAGAAGTATAGTACTCTATACATTGTTATATTCAAG
CTTGAATATAACAATGTATAGAGTACTATACTTCTCTTACCAACCACCTCATTTAATTTTCAACTAATTTTACCCCCAACCACCCTTCTAGATTTTTTAC[G/A]
ATTTGGTCCTTTTCTAAAACTTATTTTACAAAGAGACCCTTGGAAAAACTTATTCCAGGAATAGTTCTTTTTGTGGCACCAGAGGCGCTGCCGCCGTGGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 85.60% | 14.40% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 76.70% | 23.20% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 89.20% | 10.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 76.30% | 23.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 90.50% | 9.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 69.20% | 30.80% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 77.60% | 22.30% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0421433477 | C -> T | LOC_Os04g35260.1 | intron_variant ; MODIFIER | silent_mutation | Average:63.326; most accessible tissue: Callus, score: 87.556 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0421433477 | 4.80E-06 | 4.80E-06 | mr1468 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421433477 | NA | 2.24E-06 | mr1380_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421433477 | NA | 1.89E-07 | mr1561_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421433477 | NA | 1.86E-06 | mr1561_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421433477 | NA | 2.38E-07 | mr1875_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421433477 | NA | 5.67E-06 | mr1875_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421433477 | NA | 8.49E-08 | mr1908_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421433477 | NA | 7.79E-07 | mr1908_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |