Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0421413370:

Variant ID: vg0421413370 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 21413370
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAGCTCCACGTTCGCTGTCTGGCCTATAAATTCTCATATAAATCAGAGAAAAAGAATAACAGAGTCCATATAAAAATACAATTAAAAAAAGCTTAATTTC[G/A]
AAATTAAAAAATAAGGAATATTTGGAGGAGGAGATTATGGCCCATACATATATACAATTTAGAGCTAAGTGAAATTCGAAATCAAAAAATAAGAAAAAAA

Reverse complement sequence

TTTTTTTCTTATTTTTTGATTTCGAATTTCACTTAGCTCTAAATTGTATATATGTATGGGCCATAATCTCCTCCTCCAAATATTCCTTATTTTTTAATTT[C/T]
GAAATTAAGCTTTTTTTAATTGTATTTTTATATGGACTCTGTTATTCTTTTTCTCTGATTTATATGAGAATTTATAGGCCAGACAGCGAACGTGGAGCTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.90%	6.80%	0.30%	0.00%	NA
All Indica	2759	90.00%	9.60%	0.40%	0.00%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	81.00%	18.20%	0.74%	0.00%	NA
Indica I	595	90.60%	8.70%	0.67%	0.00%	NA
Indica II	465	98.90%	0.90%	0.22%	0.00%	NA
Indica III	913	85.10%	14.70%	0.22%	0.00%	NA
Indica Intermediate	786	89.80%	9.70%	0.51%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.60%	0.40%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	96.90%	2.10%	1.04%	0.00%	NA
Intermediate	90	97.80%	2.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0421413370	G -> A	LOC_Os04g35240.1	upstream_gene_variant ; 1126.0bp to feature; MODIFIER	silent_mutation	Average:26.542; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg0421413370	G -> A	LOC_Os04g35230.1	downstream_gene_variant ; 1502.0bp to feature; MODIFIER	silent_mutation	Average:26.542; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg0421413370	G -> A	LOC_Os04g35230-LOC_Os04g35240	intergenic_region ; MODIFIER	silent_mutation	Average:26.542; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0421413370	1.61E-06	1.61E-06	mr1061_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421413370	NA	2.33E-12	mr1739_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421413370	NA	1.95E-09	mr1739_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251