\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0421391589:

Variant ID: vg0421391589 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 21391589
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:


AAACCAGACGATTTACCCACCTTGACCCAATCCATAGTGATTTTGTCCAACGTGGCGCACACGTGGCAATCCAGTCAATGTTTTTTTAATAAAAAATTGT[G/A]
GGACCCGCATGTCATCTCTTCTTCCTCTCTCTACTCTCTCTCGCTCTTTTCTCTCTCACGCAGTGCACACGGCGAGGACGGGCAGTGGGCGTGGTCAGTT

Reverse complement sequence

AACTGACCACGCCCACTGCCCGTCCTCGCCGTGTGCACTGCGTGAGAGAGAAAAGAGCGAGAGAGAGTAGAGAGAGGAAGAAGAGATGACATGCGGGTCC[C/T]
ACAATTTTTTATTAAAAAAACATTGACTGGATTGCCACGTGTGCGCCACGTTGGACAAAATCACTATGGATTGGGTCAAGGTGGGTAAATCGTCTGGTTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.50% 2.60% 0.91% 13.97% NA
All Indica  2759 77.60% 0.30% 0.11% 21.96% NA
All Japonica  1512 89.70% 5.40% 2.51% 2.38% NA
Aus  269 95.20% 1.50% 0.37% 2.97% NA
Indica I  595 84.50% 0.00% 0.17% 15.29% NA
Indica II  465 80.60% 0.00% 0.00% 19.35% NA
Indica III  913 70.40% 0.80% 0.22% 28.59% NA
Indica Intermediate  786 78.90% 0.30% 0.00% 20.87% NA
Temperate Japonica  767 98.20% 0.30% 1.04% 0.52% NA
Tropical Japonica  504 92.50% 4.20% 1.98% 1.39% NA
Japonica Intermediate  241 57.30% 24.10% 8.30% 10.37% NA
VI/Aromatic  96 71.90% 25.00% 0.00% 3.12% NA
Intermediate  90 85.60% 5.60% 1.11% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0421391589 G -> DEL N N silent_mutation Average:57.809; most accessible tissue: Zhenshan97 young leaf, score: 77.101 N N N N
vg0421391589 G -> A LOC_Os04g35200.1 upstream_gene_variant ; 3997.0bp to feature; MODIFIER silent_mutation Average:57.809; most accessible tissue: Zhenshan97 young leaf, score: 77.101 N N N N
vg0421391589 G -> A LOC_Os04g35200-LOC_Os04g35210 intergenic_region ; MODIFIER silent_mutation Average:57.809; most accessible tissue: Zhenshan97 young leaf, score: 77.101 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0421391589 3.20E-09 2.47E-11 mr1113 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421391589 NA 3.87E-09 mr1114 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421391589 NA 8.97E-06 mr1116 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421391589 1.06E-06 4.50E-11 mr1117 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421391589 NA 7.08E-11 mr1118 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421391589 1.91E-06 2.22E-09 mr1119 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421391589 NA 2.00E-07 mr1120 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421391589 1.90E-06 3.27E-11 mr1123 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421391589 NA 7.98E-08 mr1240 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421391589 6.75E-08 1.68E-14 mr1242 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421391589 2.24E-07 3.37E-11 mr1247 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421391589 NA 1.89E-07 mr1495 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421391589 NA 5.68E-10 mr1496 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421391589 NA 4.93E-07 mr1693 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421391589 NA 2.77E-06 mr1736 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421391589 NA 4.14E-07 mr1917 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421391589 NA 4.72E-06 mr1936 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421391589 NA 5.18E-06 mr1995 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421391589 6.18E-06 1.43E-09 mr1113_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421391589 2.26E-07 7.00E-12 mr1114_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421391589 2.72E-08 5.19E-13 mr1117_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421391589 1.77E-07 2.72E-13 mr1118_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421391589 5.54E-08 1.07E-12 mr1119_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421391589 1.69E-06 1.65E-10 mr1120_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421391589 2.85E-08 1.27E-13 mr1123_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421391589 NA 7.71E-08 mr1150_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421391589 1.48E-08 2.21E-14 mr1240_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421391589 5.36E-07 1.18E-12 mr1242_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421391589 8.41E-08 2.81E-12 mr1247_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421391589 3.83E-06 2.57E-11 mr1495_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421391589 3.83E-08 9.44E-14 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421391589 NA 9.73E-07 mr1679_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421391589 NA 5.22E-08 mr1691_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421391589 NA 1.84E-06 mr1720_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421391589 NA 4.90E-06 mr1861_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421391589 1.20E-06 6.25E-11 mr1936_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251