\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0421388196:

Variant ID: vg0421388196 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 21388196
Reference Allele: AAlternative Allele: G,C
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, G: 0.00, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:


TAAGTAGATCAAAAATGTTTCACTCGTTTAAATCAGGTGTTGTTTCACCTTATATAAAAACAATGTTTCAGCAAATAGTGAAAGAATGTTTCAGTTCACT[A/G,C]
CAACATTAGATTTATACATAGTGAAACATTATGATTGCACTAGGTGAAACTGTTTGATGGTATTTTGGTGATTATACATGTACACAAGACTTACTCATGA

Reverse complement sequence

TCATGAGTAAGTCTTGTGTACATGTATAATCACCAAAATACCATCAAACAGTTTCACCTAGTGCAATCATAATGTTTCACTATGTATAAATCTAATGTTG[T/C,G]
AGTGAACTGAAACATTCTTTCACTATTTGCTGAAACATTGTTTTTATATAAGGTGAAACAACACCTGATTTAAACGAGTGAAACATTTTTGATCTACTTA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.10% 2.40% 1.10% 13.44% NA
All Indica  2759 78.70% 0.10% 1.38% 19.79% NA
All Japonica  1512 89.40% 5.20% 0.79% 4.56% NA
Aus  269 95.50% 0.00% 0.37% 4.09% NA
Indica I  595 85.50% 0.00% 1.51% 12.94% NA
Indica II  465 81.30% 0.00% 1.29% 17.42% NA
Indica III  913 72.20% 0.20% 1.42% 26.18% NA
Indica Intermediate  786 79.50% 0.30% 1.27% 18.96% NA
Temperate Japonica  767 97.90% 1.40% 0.26% 0.39% NA
Tropical Japonica  504 92.30% 4.40% 0.60% 2.78% NA
Japonica Intermediate  241 56.40% 19.10% 2.90% 21.58% NA
VI/Aromatic  96 71.90% 25.00% 0.00% 3.12% NA
Intermediate  90 86.70% 5.60% 1.11% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0421388196 A -> C LOC_Os04g35200.1 upstream_gene_variant ; 604.0bp to feature; MODIFIER N Average:52.79; most accessible tissue: Callus, score: 77.392 N N N N
vg0421388196 A -> C LOC_Os04g35190.1 downstream_gene_variant ; 2844.0bp to feature; MODIFIER N Average:52.79; most accessible tissue: Callus, score: 77.392 N N N N
vg0421388196 A -> C LOC_Os04g35200-LOC_Os04g35210 intergenic_region ; MODIFIER N Average:52.79; most accessible tissue: Callus, score: 77.392 N N N N
vg0421388196 A -> DEL N N silent_mutation Average:52.79; most accessible tissue: Callus, score: 77.392 N N N N
vg0421388196 A -> G LOC_Os04g35200.1 upstream_gene_variant ; 604.0bp to feature; MODIFIER silent_mutation Average:52.79; most accessible tissue: Callus, score: 77.392 N N N N
vg0421388196 A -> G LOC_Os04g35190.1 downstream_gene_variant ; 2844.0bp to feature; MODIFIER silent_mutation Average:52.79; most accessible tissue: Callus, score: 77.392 N N N N
vg0421388196 A -> G LOC_Os04g35200-LOC_Os04g35210 intergenic_region ; MODIFIER silent_mutation Average:52.79; most accessible tissue: Callus, score: 77.392 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0421388196 2.68E-07 2.68E-07 mr1098 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421388196 NA 1.65E-06 mr1101 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421388196 1.91E-07 2.36E-09 mr1113 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421388196 6.77E-08 2.05E-11 mr1114 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421388196 NA 4.08E-07 mr1116 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421388196 1.24E-07 2.85E-12 mr1117 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421388196 4.90E-06 1.96E-11 mr1118 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421388196 2.74E-07 3.25E-10 mr1119 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421388196 5.14E-09 2.35E-11 mr1120 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421388196 9.36E-10 1.05E-14 mr1123 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421388196 NA 1.40E-06 mr1150 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421388196 3.20E-06 3.20E-06 mr1197 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421388196 8.05E-06 9.76E-09 mr1240 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421388196 9.12E-09 9.37E-16 mr1242 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421388196 5.58E-10 7.82E-14 mr1247 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421388196 NA 6.45E-06 mr1441 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421388196 NA 1.56E-08 mr1495 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421388196 4.10E-06 1.34E-10 mr1496 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421388196 NA 9.20E-08 mr1693 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421388196 NA 6.50E-07 mr1736 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421388196 9.91E-06 1.39E-08 mr1917 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421388196 NA 4.34E-07 mr1936 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421388196 NA 5.42E-07 mr1961 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421388196 NA 9.14E-07 mr1098_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421388196 3.45E-08 1.45E-11 mr1113_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421388196 1.94E-10 6.19E-15 mr1114_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421388196 4.39E-11 5.61E-16 mr1117_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421388196 5.27E-10 3.24E-15 mr1118_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421388196 4.60E-10 6.48E-15 mr1119_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421388196 2.70E-09 4.35E-13 mr1120_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421388196 5.29E-11 6.51E-16 mr1123_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421388196 2.27E-06 1.96E-08 mr1150_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421388196 9.60E-12 1.17E-17 mr1240_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421388196 1.45E-09 2.67E-15 mr1242_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421388196 1.17E-09 6.88E-14 mr1247_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421388196 2.79E-09 9.49E-14 mr1495_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421388196 4.23E-11 3.35E-17 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421388196 NA 4.27E-07 mr1691_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421388196 NA 2.04E-07 mr1794_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421388196 NA 4.30E-08 mr1861_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421388196 3.88E-09 8.41E-13 mr1936_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251