| Variant ID: vg0421388196 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 21388196 |
| Reference Allele: A | Alternative Allele: G,C |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, G: 0.00, others allele: 0.00, population size: 263. )
TAAGTAGATCAAAAATGTTTCACTCGTTTAAATCAGGTGTTGTTTCACCTTATATAAAAACAATGTTTCAGCAAATAGTGAAAGAATGTTTCAGTTCACT[A/G,C]
CAACATTAGATTTATACATAGTGAAACATTATGATTGCACTAGGTGAAACTGTTTGATGGTATTTTGGTGATTATACATGTACACAAGACTTACTCATGA
TCATGAGTAAGTCTTGTGTACATGTATAATCACCAAAATACCATCAAACAGTTTCACCTAGTGCAATCATAATGTTTCACTATGTATAAATCTAATGTTG[T/C,G]
AGTGAACTGAAACATTCTTTCACTATTTGCTGAAACATTGTTTTTATATAAGGTGAAACAACACCTGATTTAAACGAGTGAAACATTTTTGATCTACTTA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.10% | 2.40% | 1.10% | 13.44% | NA |
| All Indica | 2759 | 78.70% | 0.10% | 1.38% | 19.79% | NA |
| All Japonica | 1512 | 89.40% | 5.20% | 0.79% | 4.56% | NA |
| Aus | 269 | 95.50% | 0.00% | 0.37% | 4.09% | NA |
| Indica I | 595 | 85.50% | 0.00% | 1.51% | 12.94% | NA |
| Indica II | 465 | 81.30% | 0.00% | 1.29% | 17.42% | NA |
| Indica III | 913 | 72.20% | 0.20% | 1.42% | 26.18% | NA |
| Indica Intermediate | 786 | 79.50% | 0.30% | 1.27% | 18.96% | NA |
| Temperate Japonica | 767 | 97.90% | 1.40% | 0.26% | 0.39% | NA |
| Tropical Japonica | 504 | 92.30% | 4.40% | 0.60% | 2.78% | NA |
| Japonica Intermediate | 241 | 56.40% | 19.10% | 2.90% | 21.58% | NA |
| VI/Aromatic | 96 | 71.90% | 25.00% | 0.00% | 3.12% | NA |
| Intermediate | 90 | 86.70% | 5.60% | 1.11% | 6.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0421388196 | A -> C | LOC_Os04g35200.1 | upstream_gene_variant ; 604.0bp to feature; MODIFIER | N | Average:52.79; most accessible tissue: Callus, score: 77.392 | N | N | N | N |
| vg0421388196 | A -> C | LOC_Os04g35190.1 | downstream_gene_variant ; 2844.0bp to feature; MODIFIER | N | Average:52.79; most accessible tissue: Callus, score: 77.392 | N | N | N | N |
| vg0421388196 | A -> C | LOC_Os04g35200-LOC_Os04g35210 | intergenic_region ; MODIFIER | N | Average:52.79; most accessible tissue: Callus, score: 77.392 | N | N | N | N |
| vg0421388196 | A -> DEL | N | N | silent_mutation | Average:52.79; most accessible tissue: Callus, score: 77.392 | N | N | N | N |
| vg0421388196 | A -> G | LOC_Os04g35200.1 | upstream_gene_variant ; 604.0bp to feature; MODIFIER | silent_mutation | Average:52.79; most accessible tissue: Callus, score: 77.392 | N | N | N | N |
| vg0421388196 | A -> G | LOC_Os04g35190.1 | downstream_gene_variant ; 2844.0bp to feature; MODIFIER | silent_mutation | Average:52.79; most accessible tissue: Callus, score: 77.392 | N | N | N | N |
| vg0421388196 | A -> G | LOC_Os04g35200-LOC_Os04g35210 | intergenic_region ; MODIFIER | silent_mutation | Average:52.79; most accessible tissue: Callus, score: 77.392 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0421388196 | 2.68E-07 | 2.68E-07 | mr1098 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421388196 | NA | 1.65E-06 | mr1101 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421388196 | 1.91E-07 | 2.36E-09 | mr1113 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421388196 | 6.77E-08 | 2.05E-11 | mr1114 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421388196 | NA | 4.08E-07 | mr1116 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421388196 | 1.24E-07 | 2.85E-12 | mr1117 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421388196 | 4.90E-06 | 1.96E-11 | mr1118 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421388196 | 2.74E-07 | 3.25E-10 | mr1119 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421388196 | 5.14E-09 | 2.35E-11 | mr1120 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421388196 | 9.36E-10 | 1.05E-14 | mr1123 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/