Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0421387991:

Variant ID: vg0421387991 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 21387991
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.01, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:

GATTTACGTGCAAAACTATTTTAAACCGATTTTTCTCTTAAATTAATTATCCAAATCATAATCCGATTACACCATTAAATTCGTTGCAATTAAATCTTCA[A/G]
AAAAAGACCACACATGGATATATTCCGACGAAAAAAATTAGCTTATTATTGATTTTTTTTAAATGTTGCACGATGTTCCACCAGGTATATCGGAATTGTC

Reverse complement sequence

GACAATTCCGATATACCTGGTGGAACATCGTGCAACATTTAAAAAAAATCAATAATAAGCTAATTTTTTTCGTCGGAATATATCCATGTGTGGTCTTTTT[T/C]
TGAAGATTTAATTGCAACGAATTTAATGGTGTAATCGGATTATGATTTGGATAATTAATTTAAGAGAAAAATCGGTTTAAAATAGTTTTGCACGTAAATC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	82.60%	2.50%	0.38%	14.43%	NA
All Indica	2759	78.80%	0.10%	0.22%	20.88%	NA
All Japonica	1512	88.40%	5.30%	0.73%	5.56%	NA
Aus	269	93.30%	1.90%	0.37%	4.46%	NA
Indica I	595	86.10%	0.00%	0.17%	13.78%	NA
Indica II	465	81.50%	0.00%	0.00%	18.49%	NA
Indica III	913	72.20%	0.20%	0.44%	27.16%	NA
Indica Intermediate	786	79.30%	0.30%	0.13%	20.36%	NA
Temperate Japonica	767	97.50%	1.40%	0.39%	0.65%	NA
Tropical Japonica	504	91.90%	4.40%	0.40%	3.37%	NA
Japonica Intermediate	241	52.30%	19.50%	2.49%	25.73%	NA
VI/Aromatic	96	70.80%	26.00%	0.00%	3.12%	NA
Intermediate	90	85.60%	6.70%	0.00%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0421387991	A -> DEL	N	N	silent_mutation	Average:51.358; most accessible tissue: Minghui63 panicle, score: 73.225	N	N	N	N
vg0421387991	A -> G	LOC_Os04g35200.1	upstream_gene_variant ; 399.0bp to feature; MODIFIER	silent_mutation	Average:51.358; most accessible tissue: Minghui63 panicle, score: 73.225	N	N	N	N
vg0421387991	A -> G	LOC_Os04g35190.1	downstream_gene_variant ; 2639.0bp to feature; MODIFIER	silent_mutation	Average:51.358; most accessible tissue: Minghui63 panicle, score: 73.225	N	N	N	N
vg0421387991	A -> G	LOC_Os04g35200-LOC_Os04g35210	intergenic_region ; MODIFIER	silent_mutation	Average:51.358; most accessible tissue: Minghui63 panicle, score: 73.225	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0421387991	2.80E-07	2.80E-07	mr1098	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421387991	NA	1.72E-06	mr1101	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421387991	2.34E-07	2.85E-09	mr1113	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421387991	8.38E-08	2.44E-11	mr1114	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421387991	NA	4.66E-07	mr1116	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421387991	1.51E-07	3.08E-12	mr1117	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421387991	5.49E-06	1.87E-11	mr1118	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421387991	3.61E-07	4.00E-10	mr1119	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421387991	6.56E-09	2.94E-11	mr1120	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421387991	1.30E-09	1.30E-14	mr1123	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421387991	NA	1.45E-06	mr1150	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421387991	3.01E-06	3.01E-06	mr1197	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421387991	NA	1.18E-08	mr1240	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421387991	1.30E-08	1.23E-15	mr1242	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421387991	7.21E-10	9.65E-14	mr1247	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421387991	NA	6.70E-06	mr1441	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421387991	NA	1.54E-08	mr1495	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421387991	5.05E-06	1.52E-10	mr1496	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421387991	NA	9.56E-08	mr1693	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421387991	NA	6.29E-07	mr1736	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421387991	NA	1.68E-08	mr1917	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421387991	NA	4.72E-07	mr1936	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421387991	NA	6.74E-07	mr1961	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421387991	NA	8.89E-07	mr1098_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421387991	4.34E-08	1.68E-11	mr1113_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421387991	2.38E-10	7.12E-15	mr1114_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421387991	5.76E-11	6.46E-16	mr1117_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421387991	6.51E-10	3.35E-15	mr1118_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421387991	6.16E-10	7.85E-15	mr1119_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421387991	3.82E-09	5.63E-13	mr1120_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421387991	6.46E-11	6.83E-16	mr1123_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421387991	2.13E-06	2.06E-08	mr1150_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421387991	1.22E-11	1.33E-17	mr1240_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421387991	1.71E-09	2.77E-15	mr1242_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421387991	1.58E-09	8.65E-14	mr1247_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421387991	3.31E-09	9.60E-14	mr1495_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421387991	5.39E-11	3.68E-17	mr1496_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421387991	NA	4.58E-07	mr1691_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421387991	NA	3.75E-08	mr1861_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421387991	4.53E-09	8.93E-13	mr1936_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251