\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0421387824:

Variant ID: vg0421387824 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 21387824
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATCAATTTAAAATTATCTATTTTTTAATACATGATTTTATTTAAAATTATCATTCACATAATTCTAATAATTTTATAGTTTTTAAAAGGTACGCCAGTCG[C/G]
TACCCCTTCCTCGGGAGCGCCTACGGATCGGGCGATCGATTCGGGGCTGAGAAATCGGGCGCGTCCGATTTACGTGCAAAACTATTTTAAACCGATTTTT

Reverse complement sequence

AAAAATCGGTTTAAAATAGTTTTGCACGTAAATCGGACGCGCCCGATTTCTCAGCCCCGAATCGATCGCCCGATCCGTAGGCGCTCCCGAGGAAGGGGTA[G/C]
CGACTGGCGTACCTTTTAAAAACTATAAAATTATTAGAATTATGTGAATGATAATTTTAAATAAAATCATGTATTAAAAAATAGATAATTTTAAATTGAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.00% 2.30% 0.28% 13.37% NA
All Indica  2759 80.40% 0.10% 0.36% 19.14% NA
All Japonica  1512 89.30% 5.10% 0.13% 5.49% NA
Aus  269 95.20% 0.00% 0.37% 4.46% NA
Indica I  595 85.40% 0.00% 0.34% 14.29% NA
Indica II  465 80.40% 0.00% 0.00% 19.57% NA
Indica III  913 75.50% 0.20% 0.55% 23.77% NA
Indica Intermediate  786 82.20% 0.30% 0.38% 17.18% NA
Temperate Japonica  767 97.30% 1.20% 0.26% 1.30% NA
Tropical Japonica  504 92.90% 4.40% 0.00% 2.78% NA
Japonica Intermediate  241 56.40% 19.10% 0.00% 24.48% NA
VI/Aromatic  96 70.80% 26.00% 0.00% 3.12% NA
Intermediate  90 87.80% 5.60% 0.00% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0421387824 C -> DEL N N silent_mutation Average:62.553; most accessible tissue: Callus, score: 88.987 N N N N
vg0421387824 C -> G LOC_Os04g35200.1 upstream_gene_variant ; 232.0bp to feature; MODIFIER silent_mutation Average:62.553; most accessible tissue: Callus, score: 88.987 N N N N
vg0421387824 C -> G LOC_Os04g35190.1 downstream_gene_variant ; 2472.0bp to feature; MODIFIER silent_mutation Average:62.553; most accessible tissue: Callus, score: 88.987 N N N N
vg0421387824 C -> G LOC_Os04g35200-LOC_Os04g35210 intergenic_region ; MODIFIER silent_mutation Average:62.553; most accessible tissue: Callus, score: 88.987 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0421387824 1.59E-09 3.70E-11 mr1113 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421387824 3.96E-10 2.38E-13 mr1114 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421387824 2.17E-07 4.72E-09 mr1116 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421387824 3.74E-11 1.28E-15 mr1117 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421387824 4.72E-08 1.04E-13 mr1118 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421387824 4.04E-11 4.07E-13 mr1119 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421387824 1.81E-10 1.24E-12 mr1120 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421387824 6.15E-12 5.56E-17 mr1123 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421387824 NA 9.58E-06 mr1150 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421387824 NA 7.93E-07 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421387824 7.88E-06 7.88E-06 mr1197 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421387824 2.04E-08 3.45E-11 mr1240 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421387824 9.03E-11 4.05E-17 mr1242 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421387824 2.76E-12 7.80E-16 mr1247 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421387824 NA 9.03E-06 mr1441 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421387824 NA 1.98E-09 mr1495 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421387824 5.79E-10 2.84E-14 mr1496 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421387824 NA 1.07E-09 mr1693 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421387824 NA 2.37E-06 mr1736 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421387824 4.78E-07 6.67E-10 mr1917 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421387824 4.97E-08 1.49E-09 mr1936 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421387824 1.13E-06 3.11E-08 mr1961 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421387824 1.14E-10 6.82E-14 mr1113_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421387824 2.41E-14 8.83E-18 mr1114_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421387824 2.40E-16 7.42E-21 mr1117_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421387824 2.81E-14 1.92E-18 mr1118_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421387824 3.21E-14 9.75E-19 mr1119_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421387824 1.67E-12 5.08E-16 mr1120_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421387824 1.66E-14 4.11E-19 mr1123_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421387824 NA 3.18E-07 mr1150_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421387824 NA 3.69E-07 mr1180_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421387824 9.12E-16 3.79E-21 mr1240_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421387824 2.69E-12 1.61E-17 mr1242_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421387824 5.60E-13 7.48E-17 mr1247_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421387824 1.38E-09 1.95E-14 mr1495_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421387824 4.24E-17 3.35E-23 mr1496_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421387824 NA 2.76E-08 mr1691_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421387824 NA 1.52E-06 mr1720_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421387824 NA 3.49E-08 mr1794_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421387824 NA 1.81E-07 mr1861_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421387824 6.83E-11 2.53E-14 mr1936_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421387824 2.12E-06 4.90E-07 mr1961_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251