\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0421384856:

Variant ID: vg0421384856 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 21384856
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, G: 0.00, others allele: 0.00, population size: 354. )

Flanking Sequence (100 bp) in Reference Genome:


TTAGTTTTTTTTCTGGCACACAGATAGAACTGGCACTCCTGTATCCAGGGCGTCGCTACACACTAGTTAGGATGCGCCTCAGGTATTTTGGCTTGAACTT[C/G]
TGTCTATGTTTTGAACTCTTGATGATTTCTCAGTGCTTCTAATTTGAAATTTGTGCGGACATTTTGTAGGCTTAGAGGCACAACTCTGGGCGCAAACAAC

Reverse complement sequence

GTTGTTTGCGCCCAGAGTTGTGCCTCTAAGCCTACAAAATGTCCGCACAAATTTCAAATTAGAAGCACTGAGAAATCATCAAGAGTTCAAAACATAGACA[G/C]
AAGTTCAAGCCAAAATACCTGAGGCGCATCCTAACTAGTGTGTAGCGACGCCCTGGATACAGGAGTGCCAGTTCTATCTGTGTGCCAGAAAAAAAACTAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.70% 18.60% 0.59% 0.17% NA
All Indica  2759 69.60% 29.20% 0.94% 0.29% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 81.00% 19.00% 0.00% 0.00% NA
Indica I  595 73.30% 26.10% 0.34% 0.34% NA
Indica II  465 72.00% 26.70% 0.65% 0.65% NA
Indica III  913 64.30% 33.80% 1.75% 0.11% NA
Indica Intermediate  786 71.40% 27.70% 0.64% 0.25% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 86.50% 12.50% 1.04% 0.00% NA
Intermediate  90 91.10% 7.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0421384856 C -> DEL N N silent_mutation Average:66.973; most accessible tissue: Zhenshan97 young leaf, score: 79.225 N N N N
vg0421384856 C -> G LOC_Os04g35200.1 downstream_gene_variant ; 450.0bp to feature; MODIFIER silent_mutation Average:66.973; most accessible tissue: Zhenshan97 young leaf, score: 79.225 N N N N
vg0421384856 C -> G LOC_Os04g35190.1 intron_variant ; MODIFIER silent_mutation Average:66.973; most accessible tissue: Zhenshan97 young leaf, score: 79.225 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0421384856 2.79E-06 1.45E-07 mr1078 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421384856 NA 5.91E-06 mr1184_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421384856 NA 3.08E-06 mr1245_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421384856 2.78E-07 2.78E-07 mr1267_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421384856 2.76E-06 7.37E-07 mr1278_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421384856 8.07E-06 8.07E-06 mr1284_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421384856 5.38E-07 5.38E-07 mr1311_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421384856 NA 7.21E-06 mr1312_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421384856 3.27E-07 3.27E-07 mr1312_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421384856 2.88E-06 NA mr1329_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421384856 4.91E-07 4.91E-07 mr1329_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421384856 1.98E-06 NA mr1337_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421384856 3.36E-07 3.36E-07 mr1337_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421384856 3.28E-06 6.79E-07 mr1373_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421384856 8.99E-06 8.99E-06 mr1374_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421384856 NA 9.55E-06 mr1445_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421384856 8.06E-06 NA mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421384856 9.66E-07 9.67E-07 mr1524_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421384856 NA 9.63E-06 mr1578_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421384856 NA 1.27E-06 mr1648_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421384856 NA 6.53E-07 mr1648_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421384856 1.07E-06 1.07E-06 mr1652_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421384856 NA 8.12E-06 mr1655_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421384856 3.79E-06 1.43E-06 mr1657_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421384856 NA 3.42E-06 mr1663_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421384856 2.65E-06 2.65E-06 mr1663_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421384856 NA 2.83E-06 mr1669_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421384856 4.16E-06 1.00E-07 mr1669_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421384856 3.79E-07 3.79E-07 mr1674_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421384856 3.56E-06 9.05E-07 mr1683_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421384856 8.45E-06 8.45E-06 mr1687_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421384856 2.66E-07 2.67E-07 mr1688_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421384856 1.03E-06 1.03E-06 mr1697_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421384856 8.94E-07 8.94E-07 mr1738_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421384856 3.11E-07 3.11E-07 mr1822_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421384856 2.78E-06 2.78E-06 mr1833_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421384856 2.37E-06 2.37E-06 mr1847_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421384856 2.15E-06 2.15E-06 mr1982_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251