Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0421366980:

Variant ID: vg0421366980 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 21366980
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 300. )

Flanking Sequence (100 bp) in Reference Genome:

TTGACATATAAAGCAATATGAGGATGGAACCTACATGCCACTGACTGTAATGTTAGTGCAATATGCGATGTTTAGTTCCCAAACAAAAACTTTTCACCCT[G/A]
TCACATCGAATGTTTGGACACATACATAGAATATTAAATATAGACAAAAAAAACTAATTACACAGATTGCGTGTAAATTGCAAGACGAATCTTTTAAGTC

Reverse complement sequence

GACTTAAAAGATTCGTCTTGCAATTTACACGCAATCTGTGTAATTAGTTTTTTTTGTCTATATTTAATATTCTATGTATGTGTCCAAACATTCGATGTGA[C/T]
AGGGTGAAAAGTTTTTGTTTGGGAACTAAACATCGCATATTGCACTAACATTACAGTCAGTGGCATGTAGGTTCCATCCTCATATTGCTTTATATGTCAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	81.60%	18.30%	0.08%	0.04%	NA
All Indica	2759	68.90%	30.90%	0.14%	0.07%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	66.60%	33.10%	0.17%	0.17%	NA
Indica II	465	73.10%	26.70%	0.00%	0.22%	NA
Indica III	913	66.50%	33.50%	0.00%	0.00%	NA
Indica Intermediate	786	71.00%	28.60%	0.38%	0.00%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	91.10%	8.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0421366980	G -> DEL	N	N	silent_mutation	Average:58.71; most accessible tissue: Minghui63 root, score: 77.832	N	N	N	N
vg0421366980	G -> A	LOC_Os04g36640.1	upstream_gene_variant ; 1593.0bp to feature; MODIFIER	silent_mutation	Average:58.71; most accessible tissue: Minghui63 root, score: 77.832	N	N	N	N
vg0421366980	G -> A	LOC_Os04g35160.1	upstream_gene_variant ; 1546.0bp to feature; MODIFIER	silent_mutation	Average:58.71; most accessible tissue: Minghui63 root, score: 77.832	N	N	N	N
vg0421366980	G -> A	LOC_Os04g35140.1	downstream_gene_variant ; 4871.0bp to feature; MODIFIER	silent_mutation	Average:58.71; most accessible tissue: Minghui63 root, score: 77.832	N	N	N	N
vg0421366980	G -> A	LOC_Os04g36640-LOC_Os04g35160	intergenic_region ; MODIFIER	silent_mutation	Average:58.71; most accessible tissue: Minghui63 root, score: 77.832	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0421366980	8.04E-06	8.04E-06	mr1267_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421366980	NA	5.09E-06	mr1312_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421366980	5.23E-06	5.23E-06	mr1312_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421366980	NA	1.46E-06	mr1373_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421366980	NA	5.10E-06	mr1648_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421366980	NA	1.51E-06	mr1655_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421366980	5.27E-06	NA	mr1657_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421366980	9.68E-07	7.34E-08	mr1657_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421366980	NA	6.55E-07	mr1669_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421366980	NA	2.28E-06	mr1669_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421366980	3.35E-06	3.35E-06	mr1674_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421366980	NA	3.61E-06	mr1683_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421366980	4.33E-06	4.33E-06	mr1688_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421366980	6.39E-06	6.38E-06	mr1822_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251