\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0421351123:

Variant ID: vg0421351123 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 21351123
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACTCGGAGGTGACGTCGAGCATGGCGGCGTCGTCGCCGCCGCGGGCGGCCTACTACGTGCAGTCGCCGAGCCACGACGACGGGGAGAACAAGACGGCGGC[G/A]
TCGTCCTTCCACTCCTCCCCCGCGGCGTCGCCGCCGCGCTCCCTCGGCAACCACTCCCGCGAGTCCTCCTCCTCCCGCTTCTCCGCCGCCAAGTCCGGCT

Reverse complement sequence

AGCCGGACTTGGCGGCGGAGAAGCGGGAGGAGGAGGACTCGCGGGAGTGGTTGCCGAGGGAGCGCGGCGGCGACGCCGCGGGGGAGGAGTGGAAGGACGA[C/T]
GCCGCCGTCTTGTTCTCCCCGTCGTCGTGGCTCGGCGACTGCACGTAGTAGGCCGCCCGCGGCGGCGACGACGCCGCCATGCTCGACGTCACCTCCGAGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.60% 3.90% 1.46% 0.00% NA
All Indica  2759 98.20% 1.30% 0.51% 0.00% NA
All Japonica  1512 89.80% 7.40% 2.78% 0.00% NA
Aus  269 86.60% 11.50% 1.86% 0.00% NA
Indica I  595 98.80% 0.00% 1.18% 0.00% NA
Indica II  465 99.80% 0.00% 0.22% 0.00% NA
Indica III  913 98.20% 1.80% 0.00% 0.00% NA
Indica Intermediate  786 96.60% 2.70% 0.76% 0.00% NA
Temperate Japonica  767 97.40% 0.00% 2.61% 0.00% NA
Tropical Japonica  504 74.80% 21.80% 3.37% 0.00% NA
Japonica Intermediate  241 97.10% 0.80% 2.07% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 85.60% 5.60% 8.89% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0421351123 G -> A LOC_Os04g35130.1 synonymous_variant ; p.Ala194Ala; LOW synonymous_codon Average:90.498; most accessible tissue: Zhenshan97 flower, score: 98.484 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0421351123 G A -0.02 -0.04 -0.03 0.0 -0.01 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0421351123 NA 1.36E-08 mr1076 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421351123 NA 4.92E-09 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421351123 NA 1.36E-06 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421351123 NA 4.87E-08 mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421351123 NA 5.91E-06 mr1408 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421351123 NA 4.55E-07 mr1411 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421351123 NA 8.13E-07 mr1560 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421351123 NA 3.69E-06 mr1949 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421351123 2.50E-07 3.76E-11 mr1082_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421351123 1.73E-06 1.64E-09 mr1083_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421351123 NA 4.53E-07 mr1103_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421351123 NA 3.82E-07 mr1104_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421351123 NA 1.68E-08 mr1226_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421351123 NA 3.69E-06 mr1408_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251