\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0421344282:

Variant ID: vg0421344282 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 21344282
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, T: 0.01, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:


GATGAAGCAGGTGCTCCGCATCCTGTACGAGCGCCTGGACCCGCTCTCCGGCGGCCTCGCCCGCGCCGTCGCCGGCGAGGAAGGGTACTACTACGGCGGC[T/G]
GGCAGAGCGGGCGGAAGGGGAAGGAGGGCGCGGAGATGCTGGCCGGCGGCGGCGGCGACGGTGGTCGGTGCCTGCCGTCGTCGTCGAGCACGTCCAGGTC

Reverse complement sequence

GACCTGGACGTGCTCGACGACGACGGCAGGCACCGACCACCGTCGCCGCCGCCGCCGGCCAGCATCTCCGCGCCCTCCTTCCCCTTCCGCCCGCTCTGCC[A/C]
GCCGCCGTAGTAGTACCCTTCCTCGCCGGCGACGGCGCGGGCGAGGCCGCCGGAGAGCGGGTCCAGGCGCTCGTACAGGATGCGGAGCACCTGCTTCATC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.20% 35.50% 0.34% 0.00% NA
All Indica  2759 86.30% 13.50% 0.22% 0.00% NA
All Japonica  1512 20.00% 79.40% 0.60% 0.00% NA
Aus  269 83.60% 16.40% 0.00% 0.00% NA
Indica I  595 88.20% 11.60% 0.17% 0.00% NA
Indica II  465 97.00% 3.00% 0.00% 0.00% NA
Indica III  913 82.50% 17.50% 0.00% 0.00% NA
Indica Intermediate  786 83.00% 16.40% 0.64% 0.00% NA
Temperate Japonica  767 13.60% 85.50% 0.91% 0.00% NA
Tropical Japonica  504 15.30% 84.70% 0.00% 0.00% NA
Japonica Intermediate  241 50.60% 48.50% 0.83% 0.00% NA
VI/Aromatic  96 84.40% 15.60% 0.00% 0.00% NA
Intermediate  90 47.80% 51.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0421344282 T -> G LOC_Os04g35114.1 missense_variant ; p.Trp402Gly; MODERATE nonsynonymous_codon ; W402G Average:91.745; most accessible tissue: Zhenshan97 panicle, score: 98.349 unknown unknown TOLERATED 0.41

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0421344282 T G 0.03 0.04 0.04 0.02 0.02 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0421344282 NA 2.96E-07 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421344282 NA 8.64E-07 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421344282 NA 3.67E-06 mr1280 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421344282 NA 2.16E-06 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421344282 NA 9.20E-06 mr1788 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421344282 NA 1.06E-06 mr1072_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421344282 NA 6.65E-07 mr1075_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421344282 NA 1.77E-08 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421344282 NA 6.70E-09 mr1149_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421344282 NA 1.92E-07 mr1180_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421344282 NA 4.74E-08 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421344282 NA 4.81E-07 mr1277_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421344282 NA 5.86E-08 mr1441_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421344282 NA 4.33E-07 mr1595_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421344282 NA 3.15E-06 mr1600_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421344282 NA 1.68E-07 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421344282 NA 4.14E-06 mr1702_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251