Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0421328067:

Variant ID: vg0421328067 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 21328067
Reference Allele: A	Alternative Allele: T,C
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, C: 0.02, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:

ACTACTTCCTTGTTCTCTAACGAACATACTTCCTAAACTACTAAATGATATTTTTTAAATAAATAAATATAAATTTTAAATTTATATACTCGGGTAATTA[A/T,C]
TTTTATATTTTTAAAAGGAAGAATTATTTTAGTGTCGGGTACTTGGGTTGTACTGACACTTCAATGCTGCAGCTTGTAAAAGTCTGAATAACAGAGCGGT

Reverse complement sequence

ACCGCTCTGTTATTCAGACTTTTACAAGCTGCAGCATTGAAGTGTCAGTACAACCCAAGTACCCGACACTAAAATAATTCTTCCTTTTAAAAATATAAAA[T/A,G]
TAATTACCCGAGTATATAAATTTAAAATTTATATTTATTTATTTAAAAAATATCATTTAGTAGTTTAGGAAGTATGTTCGTTAGAGAACAAGGAAGTAGT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	76.10%	19.90%	3.66%	0.00%	C: 0.34%
All Indica	2759	79.10%	18.90%	1.38%	0.00%	C: 0.58%
All Japonica	1512	65.30%	26.50%	8.13%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	79.30%	17.10%	2.86%	0.00%	C: 0.67%
Indica II	465	81.50%	17.60%	0.86%	0.00%	NA
Indica III	913	76.20%	23.30%	0.33%	0.00%	C: 0.11%
Indica Intermediate	786	80.90%	15.90%	1.78%	0.00%	C: 1.40%
Temperate Japonica	767	41.30%	46.90%	11.73%	0.00%	NA
Tropical Japonica	504	93.50%	3.20%	3.37%	0.00%	NA
Japonica Intermediate	241	83.00%	10.40%	6.64%	0.00%	NA
VI/Aromatic	96	95.80%	3.10%	1.04%	0.00%	NA
Intermediate	90	70.00%	17.80%	12.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0421328067	A -> C	LOC_Os04g35090.1	upstream_gene_variant ; 1649.0bp to feature; MODIFIER	silent_mutation	Average:92.807; most accessible tissue: Callus, score: 96.559	N	N	N	N
vg0421328067	A -> C	LOC_Os04g35080.1	downstream_gene_variant ; 1111.0bp to feature; MODIFIER	silent_mutation	Average:92.807; most accessible tissue: Callus, score: 96.559	N	N	N	N
vg0421328067	A -> C	LOC_Os04g35100.1	downstream_gene_variant ; 4150.0bp to feature; MODIFIER	silent_mutation	Average:92.807; most accessible tissue: Callus, score: 96.559	N	N	N	N
vg0421328067	A -> C	LOC_Os04g35080-LOC_Os04g35090	intergenic_region ; MODIFIER	silent_mutation	Average:92.807; most accessible tissue: Callus, score: 96.559	N	N	N	N
vg0421328067	A -> T	LOC_Os04g35090.1	upstream_gene_variant ; 1649.0bp to feature; MODIFIER	silent_mutation	Average:92.807; most accessible tissue: Callus, score: 96.559	N	N	N	N
vg0421328067	A -> T	LOC_Os04g35080.1	downstream_gene_variant ; 1111.0bp to feature; MODIFIER	silent_mutation	Average:92.807; most accessible tissue: Callus, score: 96.559	N	N	N	N
vg0421328067	A -> T	LOC_Os04g35100.1	downstream_gene_variant ; 4150.0bp to feature; MODIFIER	silent_mutation	Average:92.807; most accessible tissue: Callus, score: 96.559	N	N	N	N
vg0421328067	A -> T	LOC_Os04g35080-LOC_Os04g35090	intergenic_region ; MODIFIER	silent_mutation	Average:92.807; most accessible tissue: Callus, score: 96.559	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0421328067	A	C	0.0	0.0	0.0	-0.01	0.0	-0.01
vg0421328067	A	T	0.0	0.0	0.0	-0.01	-0.01	0.0

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0421328067	NA	6.33E-07	mr1252	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421328067	1.73E-06	8.76E-08	mr1550	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421328067	1.30E-07	1.30E-07	mr1267_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421328067	1.46E-06	1.46E-06	mr1311_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421328067	3.61E-06	NA	mr1549_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421328067	NA	3.98E-06	mr1669_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421328067	6.10E-06	6.10E-06	mr1674_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421328067	1.29E-06	1.29E-06	mr1688_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421328067	3.08E-06	3.08E-06	mr1983_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251