Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0421299708:

Variant ID: vg0421299708 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 21299708
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTCTTCTCTAAATTCCATCTCGTGTGGCCGGAATCACAGGAACAAAGTGATGCGTCACCTATAATGGGCCTATGGGCTTGTAACTTCTTTTGGGACCCCG[A/G]
CCCAGGTGGGGCCCATGTGGGGTGCGCCCCAAGCTGGTGGAGCACGACCCTAGGCACCCCTAGGTCATCCTCCCACCCCTATATATAGCTAGTTACCTCT

Reverse complement sequence

AGAGGTAACTAGCTATATATAGGGGTGGGAGGATGACCTAGGGGTGCCTAGGGTCGTGCTCCACCAGCTTGGGGCGCACCCCACATGGGCCCCACCTGGG[T/C]
CGGGGTCCCAAAAGAAGTTACAAGCCCATAGGCCCATTATAGGTGACGCATCACTTTGTTCCTGTGATTCCGGCCACACGAGATGGAATTTAGAGAAGAG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	56.80%	0.40%	17.31%	25.45%	NA
All Indica	2759	43.30%	0.50%	22.65%	33.53%	NA
All Japonica	1512	81.70%	0.00%	1.59%	16.73%	NA
Aus	269	58.70%	0.00%	41.26%	0.00%	NA
Indica I	595	36.60%	0.20%	16.64%	46.55%	NA
Indica II	465	26.00%	0.90%	12.69%	60.43%	NA
Indica III	913	51.70%	0.70%	32.86%	14.79%	NA
Indica Intermediate	786	49.00%	0.30%	21.25%	29.52%	NA
Temperate Japonica	767	86.80%	0.00%	0.00%	13.17%	NA
Tropical Japonica	504	85.30%	0.00%	4.56%	10.12%	NA
Japonica Intermediate	241	57.70%	0.00%	0.41%	41.91%	NA
VI/Aromatic	96	31.20%	6.20%	51.04%	11.46%	NA
Intermediate	90	72.20%	2.20%	10.00%	15.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0421299708	A -> DEL	N	N	silent_mutation	Average:34.052; most accessible tissue: Zhenshan97 flag leaf, score: 64.768	N	N	N	N
vg0421299708	A -> G	LOC_Os04g35050.1	intron_variant ; MODIFIER	silent_mutation	Average:34.052; most accessible tissue: Zhenshan97 flag leaf, score: 64.768	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0421299708	NA	1.78E-06	mr1125	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421299708	NA	1.36E-07	mr1220	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421299708	NA	6.99E-10	mr1352	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421299708	NA	2.20E-06	mr1627	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421299708	NA	3.60E-10	mr1011_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421299708	NA	2.52E-06	mr1011_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421299708	NA	7.78E-07	mr1158_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421299708	NA	6.28E-07	mr1184_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421299708	NA	2.11E-06	mr1184_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421299708	NA	1.41E-06	mr1220_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421299708	5.39E-06	5.39E-06	mr1267_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421299708	NA	2.45E-08	mr1277_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421299708	NA	1.66E-06	mr1278_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421299708	2.73E-06	2.73E-06	mr1312_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421299708	NA	1.75E-06	mr1329_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421299708	NA	1.90E-06	mr1378_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421299708	NA	9.92E-06	mr1428_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421299708	NA	3.11E-06	mr1524_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421299708	NA	3.68E-07	mr1641_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421299708	NA	1.13E-09	mr1653_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421299708	8.57E-06	8.57E-06	mr1665_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421299708	NA	3.10E-08	mr1683_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421299708	3.54E-06	5.04E-08	mr1683_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421299708	1.17E-06	1.17E-06	mr1687_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421299708	8.07E-06	8.06E-06	mr1738_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421299708	NA	2.94E-08	mr1759_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421299708	NA	3.98E-07	mr1766_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421299708	2.80E-06	2.80E-06	mr1812_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421299708	8.10E-06	8.10E-06	mr1816_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421299708	1.72E-06	1.72E-06	mr1833_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251