\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0421297234:

Variant ID: vg0421297234 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 21297234
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.72, G: 0.28, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


CATCAACTTGGCTGATGGATGCAATTTGGTAAAAATGAGCGTTCTAGTGCAACAACTTGCAATGTAGGTGCAATTTAGTATAAGAACTTTATAAGTGATC[G/A]
TATAAATACAACAACTTGCAAGATAGGTACGATTTTGATACAATAAATTAAAAAGTTATGCGACAACTTAATTATTTTGAGCATTTTTTAATAAAAATTC

Reverse complement sequence

GAATTTTTATTAAAAAATGCTCAAAATAATTAAGTTGTCGCATAACTTTTTAATTTATTGTATCAAAATCGTACCTATCTTGCAAGTTGTTGTATTTATA[C/T]
GATCACTTATAAAGTTCTTATACTAAATTGCACCTACATTGCAAGTTGTTGCACTAGAACGCTCATTTTTACCAAATTGCATCCATCAGCCAAGTTGATG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.80% 43.20% 0.00% 0.00% NA
All Indica  2759 42.10% 57.90% 0.00% 0.00% NA
All Japonica  1512 82.50% 17.50% 0.00% 0.00% NA
Aus  269 52.00% 48.00% 0.00% 0.00% NA
Indica I  595 36.00% 64.00% 0.00% 0.00% NA
Indica II  465 24.90% 75.10% 0.00% 0.00% NA
Indica III  913 50.80% 49.20% 0.00% 0.00% NA
Indica Intermediate  786 46.80% 53.20% 0.00% 0.00% NA
Temperate Japonica  767 86.60% 13.40% 0.00% 0.00% NA
Tropical Japonica  504 88.70% 11.30% 0.00% 0.00% NA
Japonica Intermediate  241 56.80% 43.20% 0.00% 0.00% NA
VI/Aromatic  96 70.80% 29.20% 0.00% 0.00% NA
Intermediate  90 73.30% 26.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0421297234 G -> A LOC_Os04g35030.1 upstream_gene_variant ; 3591.0bp to feature; MODIFIER silent_mutation Average:25.276; most accessible tissue: Callus, score: 45.906 N N N N
vg0421297234 G -> A LOC_Os04g35050.1 upstream_gene_variant ; 2170.0bp to feature; MODIFIER silent_mutation Average:25.276; most accessible tissue: Callus, score: 45.906 N N N N
vg0421297234 G -> A LOC_Os04g35030-LOC_Os04g35050 intergenic_region ; MODIFIER silent_mutation Average:25.276; most accessible tissue: Callus, score: 45.906 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0421297234 NA 3.37E-06 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421297234 NA 8.67E-07 mr1072_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421297234 NA 7.63E-07 mr1075_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421297234 NA 2.06E-06 mr1149_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421297234 NA 3.04E-06 mr1184_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421297234 NA 1.16E-06 mr1277_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421297234 NA 5.33E-06 mr1278_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421297234 3.59E-06 3.59E-06 mr1312_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421297234 NA 4.74E-06 mr1441_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421297234 NA 5.52E-06 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421297234 NA 5.01E-06 mr1595_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421297234 NA 3.25E-06 mr1600_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421297234 NA 1.75E-06 mr1641_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421297234 5.62E-06 5.62E-06 mr1665_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421297234 NA 3.09E-07 mr1683_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421297234 5.13E-07 5.13E-07 mr1687_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421297234 4.36E-06 4.36E-06 mr1738_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421297234 NA 1.74E-06 mr1759_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421297234 NA 2.89E-06 mr1766_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421297234 4.72E-06 4.72E-06 mr1812_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421297234 3.47E-06 3.47E-06 mr1816_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421297234 2.05E-06 2.04E-06 mr1833_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251