\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0421295781:

Variant ID: vg0421295781 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 21295781
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 272. )

Flanking Sequence (100 bp) in Reference Genome:


TATAGTAGATGAATTACTTGAGATACACTCTACTACAATAATTGTCGTACACATACGTGTTTTTTTCCCTCGTCACAGGGTGAAATAGATGTGTTTGTTT[A/G]
CAAAATCGGCTCTATTATAAGCTGTTGACCAACATGATCATATTGAAATTAATCTTATATACAATATGATCATGATACATGACTCACATATGTGTGCTAG

Reverse complement sequence

CTAGCACACATATGTGAGTCATGTATCATGATCATATTGTATATAAGATTAATTTCAATATGATCATGTTGGTCAACAGCTTATAATAGAGCCGATTTTG[T/C]
AAACAAACACATCTATTTCACCCTGTGACGAGGGAAAAAAACACGTATGTGTACGACAATTATTGTAGTAGAGTGTATCTCAAGTAATTCATCTACTATA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.70% 11.20% 1.12% 0.00% NA
All Indica  2759 80.20% 18.80% 0.98% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 90.30% 0.00% 9.67% 0.00% NA
Indica I  595 83.90% 16.10% 0.00% 0.00% NA
Indica II  465 81.90% 18.10% 0.00% 0.00% NA
Indica III  913 74.00% 23.70% 2.30% 0.00% NA
Indica Intermediate  786 83.60% 15.60% 0.76% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 94.40% 5.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0421295781 A -> G LOC_Os04g35030.1 upstream_gene_variant ; 2138.0bp to feature; MODIFIER silent_mutation Average:57.105; most accessible tissue: Minghui63 flag leaf, score: 80.786 N N N N
vg0421295781 A -> G LOC_Os04g35050.1 upstream_gene_variant ; 3623.0bp to feature; MODIFIER silent_mutation Average:57.105; most accessible tissue: Minghui63 flag leaf, score: 80.786 N N N N
vg0421295781 A -> G LOC_Os04g35030-LOC_Os04g35050 intergenic_region ; MODIFIER silent_mutation Average:57.105; most accessible tissue: Minghui63 flag leaf, score: 80.786 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0421295781 5.63E-06 NA mr1245_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421295781 NA 5.92E-06 mr1245_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421295781 2.49E-06 NA mr1267_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421295781 1.48E-07 1.48E-07 mr1267_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421295781 9.38E-07 9.38E-07 mr1311_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421295781 8.27E-06 8.27E-06 mr1312_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421295781 6.34E-06 NA mr1373_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421295781 9.90E-06 2.59E-06 mr1373_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421295781 NA 9.26E-06 mr1397_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421295781 4.67E-06 4.66E-06 mr1651_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421295781 NA 4.72E-06 mr1669_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421295781 NA 5.15E-06 mr1669_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421295781 3.22E-06 3.22E-06 mr1674_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421295781 9.79E-07 9.79E-07 mr1688_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421295781 1.38E-06 1.38E-06 mr1983_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251