\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0421287077:

Variant ID: vg0421287077 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 21287077
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAATCATATAACTGCATGGACACGAATTTCATCGGAATACAATTAATATAATATGCGAGAATGTGTGCATGCTACGGTGTAATTGGCATAGGGTTTTAAT[T/C]
GATGCATGCATTGTGAGAGATTGTGTGCATGGTGTCTTGATTGATGTGATTTAAATGGTTCTTGGTCTTGGTACATAAACTTATATGATGATCAATTTGG

Reverse complement sequence

CCAAATTGATCATCATATAAGTTTATGTACCAAGACCAAGAACCATTTAAATCACATCAATCAAGACACCATGCACACAATCTCTCACAATGCATGCATC[A/G]
ATTAAAACCCTATGCCAATTACACCGTAGCATGCACACATTCTCGCATATTATATTAATTGTATTCCGATGAAATTCGTGTCCATGCAGTTATATGATTA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.10% 20.40% 0.89% 22.56% NA
All Indica  2759 41.50% 18.90% 1.45% 38.20% NA
All Japonica  1512 86.00% 13.90% 0.07% 0.07% NA
Aus  269 44.20% 55.80% 0.00% 0.00% NA
Indica I  595 39.80% 7.90% 1.34% 50.92% NA
Indica II  465 25.80% 7.70% 1.72% 64.73% NA
Indica III  913 46.50% 32.30% 1.20% 19.93% NA
Indica Intermediate  786 46.10% 18.20% 1.65% 34.10% NA
Temperate Japonica  767 96.00% 3.90% 0.13% 0.00% NA
Tropical Japonica  504 84.70% 15.10% 0.00% 0.20% NA
Japonica Intermediate  241 56.80% 43.20% 0.00% 0.00% NA
VI/Aromatic  96 27.10% 72.90% 0.00% 0.00% NA
Intermediate  90 71.10% 15.60% 1.11% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0421287077 T -> C LOC_Os04g35020.1 upstream_gene_variant ; 1817.0bp to feature; MODIFIER silent_mutation Average:39.693; most accessible tissue: Zhenshan97 flower, score: 67.623 N N N N
vg0421287077 T -> C LOC_Os04g35030.1 downstream_gene_variant ; 1053.0bp to feature; MODIFIER silent_mutation Average:39.693; most accessible tissue: Zhenshan97 flower, score: 67.623 N N N N
vg0421287077 T -> C LOC_Os04g35020-LOC_Os04g35030 intergenic_region ; MODIFIER silent_mutation Average:39.693; most accessible tissue: Zhenshan97 flower, score: 67.623 N N N N
vg0421287077 T -> DEL N N silent_mutation Average:39.693; most accessible tissue: Zhenshan97 flower, score: 67.623 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0421287077 NA 1.39E-06 mr1113 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421287077 NA 1.37E-07 mr1117 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421287077 NA 8.34E-07 mr1118 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421287077 NA 2.20E-06 mr1119 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421287077 NA 1.82E-06 mr1123 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421287077 NA 1.02E-07 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421287077 NA 1.58E-07 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421287077 NA 2.27E-07 mr1242 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421287077 NA 9.99E-07 mr1247 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421287077 NA 2.68E-06 mr1495 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421287077 NA 9.79E-07 mr1496 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421287077 NA 1.06E-06 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421287077 3.06E-06 3.10E-06 mr1037_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421287077 NA 1.52E-06 mr1113_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421287077 NA 3.03E-07 mr1114_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421287077 4.79E-06 3.30E-09 mr1117_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421287077 NA 9.05E-08 mr1118_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421287077 NA 2.35E-08 mr1119_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421287077 NA 1.09E-07 mr1120_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421287077 3.64E-07 6.39E-10 mr1123_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421287077 NA 1.40E-07 mr1180_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421287077 NA 8.06E-07 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421287077 6.37E-06 1.35E-09 mr1240_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421287077 NA 5.71E-08 mr1242_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421287077 NA 5.15E-08 mr1247_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421287077 NA 3.43E-08 mr1495_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421287077 2.00E-06 2.12E-10 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421287077 NA 9.59E-06 mr1861_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421287077 2.90E-06 1.67E-08 mr1936_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251