\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0421286073:

Variant ID: vg0421286073 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 21286073
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, C: 0.02, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:


ATTAATCATCATATAACGGTGTCACGTGCAGAGCGATGATGCAACAATAAAGTTAAAAAGTCATCTTCGTGCATAGTTAAATGTGTGCTATGCCACACTC[T/C]
GCTAATTCCGATATAATTTTCGACTTCCAACCAATATCGGTATATTCCGTTCTGAATTGTTCCGTTTCCGATATACCGATATTACTGATATCGTTACCGT

Reverse complement sequence

ACGGTAACGATATCAGTAATATCGGTATATCGGAAACGGAACAATTCAGAACGGAATATACCGATATTGGTTGGAAGTCGAAAATTATATCGGAATTAGC[A/G]
GAGTGTGGCATAGCACACATTTAACTATGCACGAAGATGACTTTTTAACTTTATTGTTGCATCATCGCTCTGCACGTGACACCGTTATATGATGATTAAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.30% 4.70% 0.00% 0.00% NA
All Indica  2759 94.70% 5.30% 0.00% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 73.60% 26.40% 0.00% 0.00% NA
Indica I  595 95.60% 4.40% 0.00% 0.00% NA
Indica II  465 96.80% 3.20% 0.00% 0.00% NA
Indica III  913 94.40% 5.60% 0.00% 0.00% NA
Indica Intermediate  786 93.30% 6.70% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 96.70% 3.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0421286073 T -> C LOC_Os04g35020.1 upstream_gene_variant ; 813.0bp to feature; MODIFIER silent_mutation Average:39.937; most accessible tissue: Callus, score: 71.892 N N N N
vg0421286073 T -> C LOC_Os04g35010.1 downstream_gene_variant ; 4399.0bp to feature; MODIFIER silent_mutation Average:39.937; most accessible tissue: Callus, score: 71.892 N N N N
vg0421286073 T -> C LOC_Os04g35030.1 downstream_gene_variant ; 2057.0bp to feature; MODIFIER silent_mutation Average:39.937; most accessible tissue: Callus, score: 71.892 N N N N
vg0421286073 T -> C LOC_Os04g35020-LOC_Os04g35030 intergenic_region ; MODIFIER silent_mutation Average:39.937; most accessible tissue: Callus, score: 71.892 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0421286073 NA 4.39E-07 mr1207 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421286073 NA 9.62E-06 mr1424 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421286073 NA 9.80E-07 mr1569 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421286073 NA 6.83E-08 mr1248_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421286073 NA 6.98E-06 mr1423_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251