Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0421272904:

Variant ID: vg0421272904 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 21272904
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 304. )

Flanking Sequence (100 bp) in Reference Genome:

CACTTGGCGCTTCACGCTGGCAAGATTTTTGCGTTCGCTGCCGTTCGCTCCCTCCGAAGCACAACGCGGCAGTAAATTTGCATTGACCGATCAATTGATT[G/A]
TTGTTGCTATTGTTGATGTTGTTGTTGCCGTTGTTGTTGTTGTTGTTATTGTTGTTGTTGTTGTTGTTGTTGTTGTTGTTGTTGTTACTTTTATGCATGT

Reverse complement sequence

ACATGCATAAAAGTAACAACAACAACAACAACAACAACAACAACAACAACAATAACAACAACAACAACAACGGCAACAACAACATCAACAATAGCAACAA[C/T]
AATCAATTGATCGGTCAATGCAAATTTACTGCCGCGTTGTGCTTCGGAGGGAGCGAACGGCAGCGAACGCAAAAATCTTGCCAGCGTGAAGCGCCAAGTG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.50%	14.10%	2.41%	0.00%	NA
All Indica	2759	72.20%	23.70%	4.06%	0.00%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	49.70%	38.20%	12.10%	0.00%	NA
Indica II	465	38.50%	55.70%	5.81%	0.00%	NA
Indica III	913	99.50%	0.50%	0.00%	0.00%	NA
Indica Intermediate	786	77.60%	20.70%	1.65%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	86.70%	11.10%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0421272904	G -> A	LOC_Os04g35010.1	upstream_gene_variant ; 3800.0bp to feature; MODIFIER	silent_mutation	Average:40.242; most accessible tissue: Zhenshan97 young leaf, score: 69.263	N	N	N	N
vg0421272904	G -> A	LOC_Os04g34984.1	downstream_gene_variant ; 4677.0bp to feature; MODIFIER	silent_mutation	Average:40.242; most accessible tissue: Zhenshan97 young leaf, score: 69.263	N	N	N	N
vg0421272904	G -> A	LOC_Os04g34984.2	downstream_gene_variant ; 4677.0bp to feature; MODIFIER	silent_mutation	Average:40.242; most accessible tissue: Zhenshan97 young leaf, score: 69.263	N	N	N	N
vg0421272904	G -> A	LOC_Os04g34984.3	downstream_gene_variant ; 4150.0bp to feature; MODIFIER	silent_mutation	Average:40.242; most accessible tissue: Zhenshan97 young leaf, score: 69.263	N	N	N	N
vg0421272904	G -> A	LOC_Os04g35000.1	intron_variant ; MODIFIER	silent_mutation	Average:40.242; most accessible tissue: Zhenshan97 young leaf, score: 69.263	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0421272904	NA	8.65E-18	Plant_height	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0421272904	NA	3.74E-06	Spikelet_length	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0421272904	NA	2.45E-06	mr1094	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421272904	NA	4.26E-08	mr1133	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421272904	NA	7.94E-06	mr1667	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421272904	NA	2.71E-08	mr1929	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421272904	NA	4.49E-06	mr1015_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421272904	NA	2.92E-07	mr1110_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421272904	NA	8.06E-06	mr1133_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421272904	NA	3.64E-14	mr1172_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421272904	NA	1.51E-06	mr1172_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421272904	NA	5.87E-06	mr1184_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421272904	NA	7.00E-07	mr1245_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421272904	NA	6.19E-06	mr1278_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421272904	NA	1.34E-06	mr1373_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421272904	NA	1.17E-06	mr1378_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421272904	NA	4.21E-06	mr1428_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251