Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0421227235:

Variant ID: vg0421227235 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 21227235
Reference Allele: T	Alternative Allele: G
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.78, T: 0.22, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:

TTTGCAGATTACAAAGTTAGAAAAAGCTAAAGCCGTAGAAGAGCTCCCTCAGCGTAATATAGCAGGATAATACTAATCAAAGAAAATCCATTATCAAAAA[T/G]
ATACTAACAAGCATACGGCGTACAGTAATGTACGCATTACAACTACAGGTTTTGTCTAGGATAACAATCTCATTAAAATCCAGACAATAGATGCCCAATT

Reverse complement sequence

AATTGGGCATCTATTGTCTGGATTTTAATGAGATTGTTATCCTAGACAAAACCTGTAGTTGTAATGCGTACATTACTGTACGCCGTATGCTTGTTAGTAT[A/C]
TTTTTGATAATGGATTTTCTTTGATTAGTATTATCCTGCTATATTACGCTGAGGGAGCTCTTCTACGGCTTTAGCTTTTTCTAACTTTGTAATCTGCAAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.60%	30.60%	3.85%	0.00%	NA
All Indica	2759	50.80%	43.10%	6.13%	0.00%	NA
All Japonica	1512	98.10%	1.80%	0.07%	0.00%	NA
Aus	269	32.70%	64.70%	2.60%	0.00%	NA
Indica I	595	44.90%	50.60%	4.54%	0.00%	NA
Indica II	465	35.30%	63.00%	1.72%	0.00%	NA
Indica III	913	61.00%	31.40%	7.56%	0.00%	NA
Indica Intermediate	786	52.70%	39.10%	8.27%	0.00%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	95.20%	4.60%	0.20%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	58.30%	41.70%	0.00%	0.00%	NA
Intermediate	90	75.60%	18.90%	5.56%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0421227235	T -> G	LOC_Os04g34930.1	3_prime_UTR_variant ; 464.0bp to feature; MODIFIER	silent_mutation	Average:63.739; most accessible tissue: Callus, score: 85.841	N	N	N	N
vg0421227235	T -> G	LOC_Os04g34930.3	3_prime_UTR_variant ; 464.0bp to feature; MODIFIER	silent_mutation	Average:63.739; most accessible tissue: Callus, score: 85.841	N	N	N	N
vg0421227235	T -> G	LOC_Os04g34930.2	downstream_gene_variant ; 2548.0bp to feature; MODIFIER	silent_mutation	Average:63.739; most accessible tissue: Callus, score: 85.841	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0421227235	NA	1.62E-08	mr1141	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421227235	NA	4.87E-07	mr1192	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421227235	NA	8.63E-07	mr1220	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421227235	NA	1.26E-06	mr1015_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421227235	NA	7.21E-08	mr1158_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421227235	NA	2.39E-07	mr1158_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421227235	NA	1.30E-09	mr1172_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421227235	NA	2.80E-06	mr1184_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421227235	NA	2.02E-06	mr1268_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421227235	NA	7.93E-07	mr1653_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421227235	NA	4.01E-08	mr1683_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421227235	NA	7.29E-06	mr1927_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251