\
| Variant ID: vg0421227235 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 21227235 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.78, T: 0.22, others allele: 0.00, population size: 195. )
TTTGCAGATTACAAAGTTAGAAAAAGCTAAAGCCGTAGAAGAGCTCCCTCAGCGTAATATAGCAGGATAATACTAATCAAAGAAAATCCATTATCAAAAA[T/G]
ATACTAACAAGCATACGGCGTACAGTAATGTACGCATTACAACTACAGGTTTTGTCTAGGATAACAATCTCATTAAAATCCAGACAATAGATGCCCAATT
AATTGGGCATCTATTGTCTGGATTTTAATGAGATTGTTATCCTAGACAAAACCTGTAGTTGTAATGCGTACATTACTGTACGCCGTATGCTTGTTAGTAT[A/C]
TTTTTGATAATGGATTTTCTTTGATTAGTATTATCCTGCTATATTACGCTGAGGGAGCTCTTCTACGGCTTTAGCTTTTTCTAACTTTGTAATCTGCAAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 65.60% | 30.60% | 3.85% | 0.00% | NA |
| All Indica | 2759 | 50.80% | 43.10% | 6.13% | 0.00% | NA |
| All Japonica | 1512 | 98.10% | 1.80% | 0.07% | 0.00% | NA |
| Aus | 269 | 32.70% | 64.70% | 2.60% | 0.00% | NA |
| Indica I | 595 | 44.90% | 50.60% | 4.54% | 0.00% | NA |
| Indica II | 465 | 35.30% | 63.00% | 1.72% | 0.00% | NA |
| Indica III | 913 | 61.00% | 31.40% | 7.56% | 0.00% | NA |
| Indica Intermediate | 786 | 52.70% | 39.10% | 8.27% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 95.20% | 4.60% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 58.30% | 41.70% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 75.60% | 18.90% | 5.56% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0421227235 | T -> G | LOC_Os04g34930.1 | 3_prime_UTR_variant ; 464.0bp to feature; MODIFIER | silent_mutation | Average:63.739; most accessible tissue: Callus, score: 85.841 | N | N | N | N |
| vg0421227235 | T -> G | LOC_Os04g34930.3 | 3_prime_UTR_variant ; 464.0bp to feature; MODIFIER | silent_mutation | Average:63.739; most accessible tissue: Callus, score: 85.841 | N | N | N | N |
| vg0421227235 | T -> G | LOC_Os04g34930.2 | downstream_gene_variant ; 2548.0bp to feature; MODIFIER | silent_mutation | Average:63.739; most accessible tissue: Callus, score: 85.841 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0421227235 | NA | 1.62E-08 | mr1141 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421227235 | NA | 4.87E-07 | mr1192 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421227235 | NA | 8.63E-07 | mr1220 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421227235 | NA | 1.26E-06 | mr1015_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421227235 | NA | 7.21E-08 | mr1158_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421227235 | NA | 2.39E-07 | mr1158_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421227235 | NA | 1.30E-09 | mr1172_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421227235 | NA | 2.80E-06 | mr1184_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421227235 | NA | 2.02E-06 | mr1268_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421227235 | NA | 7.93E-07 | mr1653_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421227235 | NA | 4.01E-08 | mr1683_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421227235 | NA | 7.29E-06 | mr1927_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |