Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0421220373:

Variant ID: vg0421220373 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 21220373
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTTTAAAATATGCCATCAGTATTCACGTATTTGAAACAATGCTATTACAATTTTACACAGATTCAAGATATGTCACTACCTACCATTTACAAAAAAAAAA[T/A]
TTAGATCAAATTACCCTTCTTTCCTTCTTTTTCTCCCCTCTCCTTCCTTCCACAGCTCAGAGAACAGGGGGCGGCGGTAGCAGCGAGCGGCAGCGTCGGA

Reverse complement sequence

TCCGACGCTGCCGCTCGCTGCTACCGCCGCCCCCTGTTCTCTGAGCTGTGGAAGGAAGGAGAGGGGAGAAAAAGAAGGAAAGAAGGGTAATTTGATCTAA[A/T]
TTTTTTTTTTGTAAATGGTAGGTAGTGACATATCTTGAATCTGTGTAAAATTGTAATAGCATTGTTTCAAATACGTGAATACTGATGGCATATTTTAAAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	39.00%	21.80%	4.95%	34.30%	NA
All Indica	2759	8.40%	35.00%	7.36%	49.18%	NA
All Japonica	1512	96.00%	1.70%	0.79%	1.52%	NA
Aus	269	20.10%	8.60%	2.60%	68.77%	NA
Indica I	595	12.40%	22.70%	15.46%	49.41%	NA
Indica II	465	8.60%	27.70%	6.24%	57.42%	NA
Indica III	913	3.80%	47.30%	2.30%	46.55%	NA
Indica Intermediate	786	10.70%	34.40%	7.76%	47.20%	NA
Temperate Japonica	767	98.70%	0.50%	0.78%	0.00%	NA
Tropical Japonica	504	91.10%	4.00%	0.60%	4.37%	NA
Japonica Intermediate	241	97.50%	0.80%	1.24%	0.41%	NA
VI/Aromatic	96	50.00%	4.20%	3.12%	42.71%	NA
Intermediate	90	62.20%	11.10%	10.00%	16.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0421220373	T -> DEL	N	N	silent_mutation	Average:12.371; most accessible tissue: Callus, score: 46.936	N	N	N	N
vg0421220373	T -> A	LOC_Os04g34910.1	downstream_gene_variant ; 4388.0bp to feature; MODIFIER	silent_mutation	Average:12.371; most accessible tissue: Callus, score: 46.936	N	N	N	N
vg0421220373	T -> A	LOC_Os04g34910-LOC_Os04g34930	intergenic_region ; MODIFIER	silent_mutation	Average:12.371; most accessible tissue: Callus, score: 46.936	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0421220373	NA	1.60E-06	mr1192	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421220373	NA	2.24E-06	mr1627	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421220373	NA	1.95E-06	mr1158_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421220373	NA	5.54E-07	mr1158_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421220373	NA	3.79E-06	mr1184_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421220373	NA	7.27E-07	mr1277_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421220373	NA	3.31E-06	mr1312_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421220373	1.76E-06	1.76E-06	mr1312_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421220373	NA	8.92E-07	mr1378_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421220373	NA	5.74E-06	mr1417_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421220373	NA	1.86E-07	mr1641_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421220373	2.20E-06	2.19E-06	mr1651_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421220373	NA	3.58E-07	mr1653_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421220373	7.79E-06	7.79E-06	mr1665_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421220373	NA	9.16E-06	mr1682_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421220373	NA	8.69E-08	mr1683_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421220373	1.87E-06	1.87E-06	mr1687_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421220373	NA	4.94E-06	mr1738_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421220373	1.64E-06	1.64E-06	mr1738_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421220373	NA	6.99E-09	mr1759_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421220373	NA	4.13E-09	mr1759_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421220373	NA	2.20E-06	mr1766_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421220373	2.51E-06	2.51E-06	mr1812_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421220373	3.42E-06	3.42E-06	mr1816_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421220373	4.30E-06	4.30E-06	mr1832_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421220373	8.16E-07	8.16E-07	mr1833_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421220373	NA	6.45E-06	mr1838_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421220373	NA	3.68E-06	mr1856_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251