Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0421213186:

Variant ID: vg0421213186 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 21213186
Reference Allele: T	Alternative Allele: G
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CATACTTAACCAAAAAGCATTTCAATTTTCCTCATTTTTTGGGTGAGGTTTCCTATTAGTCTGGAGTCGGCACAAGTACCACGTTCTGTTACCATTTATA[T/G]
GGTAATGTTAGATATTTGTATGACCTGCTCATTGACCTGTCTACAGTGAACAATTGTTTGTTACGATGGGTATTGGACACAGAAGCACAAAAGTAGTGCT

Reverse complement sequence

AGCACTACTTTTGTGCTTCTGTGTCCAATACCCATCGTAACAAACAATTGTTCACTGTAGACAGGTCAATGAGCAGGTCATACAAATATCTAACATTACC[A/C]
TATAAATGGTAACAGAACGTGGTACTTGTGCCGACTCCAGACTAATAGGAAACCTCACCCAAAAAATGAGGAAAATTGAAATGCTTTTTGGTTAAGTATG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.30%	0.70%	2.18%	31.82%	NA
All Indica	2759	51.00%	0.10%	2.86%	46.10%	NA
All Japonica	1512	95.80%	1.90%	1.06%	1.26%	NA
Aus	269	37.90%	0.00%	2.23%	59.85%	NA
Indica I	595	48.70%	0.00%	2.02%	49.24%	NA
Indica II	465	40.20%	0.20%	4.95%	54.62%	NA
Indica III	913	57.50%	0.00%	1.75%	40.74%	NA
Indica Intermediate	786	51.40%	0.10%	3.56%	44.91%	NA
Temperate Japonica	767	94.50%	3.80%	1.69%	0.00%	NA
Tropical Japonica	504	95.80%	0.00%	0.60%	3.57%	NA
Japonica Intermediate	241	99.60%	0.00%	0.00%	0.41%	NA
VI/Aromatic	96	59.40%	0.00%	0.00%	40.62%	NA
Intermediate	90	81.10%	2.20%	2.22%	14.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0421213186	T -> DEL	N	N	silent_mutation	Average:11.002; most accessible tissue: Callus, score: 61.814	N	N	N	N
vg0421213186	T -> G	LOC_Os04g34910.1	upstream_gene_variant ; 1758.0bp to feature; MODIFIER	silent_mutation	Average:11.002; most accessible tissue: Callus, score: 61.814	N	N	N	N
vg0421213186	T -> G	LOC_Os04g34900.1	downstream_gene_variant ; 4901.0bp to feature; MODIFIER	silent_mutation	Average:11.002; most accessible tissue: Callus, score: 61.814	N	N	N	N
vg0421213186	T -> G	LOC_Os04g34900-LOC_Os04g34910	intergenic_region ; MODIFIER	silent_mutation	Average:11.002; most accessible tissue: Callus, score: 61.814	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0421213186	8.15E-07	5.39E-07	mr1648	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421213186	2.43E-06	3.56E-07	mr1697	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251