\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0421213186:

Variant ID: vg0421213186 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 21213186
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CATACTTAACCAAAAAGCATTTCAATTTTCCTCATTTTTTGGGTGAGGTTTCCTATTAGTCTGGAGTCGGCACAAGTACCACGTTCTGTTACCATTTATA[T/G]
GGTAATGTTAGATATTTGTATGACCTGCTCATTGACCTGTCTACAGTGAACAATTGTTTGTTACGATGGGTATTGGACACAGAAGCACAAAAGTAGTGCT

Reverse complement sequence

AGCACTACTTTTGTGCTTCTGTGTCCAATACCCATCGTAACAAACAATTGTTCACTGTAGACAGGTCAATGAGCAGGTCATACAAATATCTAACATTACC[A/C]
TATAAATGGTAACAGAACGTGGTACTTGTGCCGACTCCAGACTAATAGGAAACCTCACCCAAAAAATGAGGAAAATTGAAATGCTTTTTGGTTAAGTATG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.30% 0.70% 2.18% 31.82% NA
All Indica  2759 51.00% 0.10% 2.86% 46.10% NA
All Japonica  1512 95.80% 1.90% 1.06% 1.26% NA
Aus  269 37.90% 0.00% 2.23% 59.85% NA
Indica I  595 48.70% 0.00% 2.02% 49.24% NA
Indica II  465 40.20% 0.20% 4.95% 54.62% NA
Indica III  913 57.50% 0.00% 1.75% 40.74% NA
Indica Intermediate  786 51.40% 0.10% 3.56% 44.91% NA
Temperate Japonica  767 94.50% 3.80% 1.69% 0.00% NA
Tropical Japonica  504 95.80% 0.00% 0.60% 3.57% NA
Japonica Intermediate  241 99.60% 0.00% 0.00% 0.41% NA
VI/Aromatic  96 59.40% 0.00% 0.00% 40.62% NA
Intermediate  90 81.10% 2.20% 2.22% 14.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0421213186 T -> DEL N N silent_mutation Average:11.002; most accessible tissue: Callus, score: 61.814 N N N N
vg0421213186 T -> G LOC_Os04g34910.1 upstream_gene_variant ; 1758.0bp to feature; MODIFIER silent_mutation Average:11.002; most accessible tissue: Callus, score: 61.814 N N N N
vg0421213186 T -> G LOC_Os04g34900.1 downstream_gene_variant ; 4901.0bp to feature; MODIFIER silent_mutation Average:11.002; most accessible tissue: Callus, score: 61.814 N N N N
vg0421213186 T -> G LOC_Os04g34900-LOC_Os04g34910 intergenic_region ; MODIFIER silent_mutation Average:11.002; most accessible tissue: Callus, score: 61.814 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0421213186 8.15E-07 5.39E-07 mr1648 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421213186 2.43E-06 3.56E-07 mr1697 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251