\
| Variant ID: vg0421189516 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 21189516 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TATAATATCTATGTGCAGTTTAGTTCTAATTTACCGGCTATTCTCACACGTTGGCTTTTTTTATTGACTGAGATATCATTTTCACTACAGTCCAAATGTG[T/C]
TGGTCAATTCATAATCGATCAGCAGGCCTGGAATTTGTCTCAAGGTATATACATGGAATAGTGTTCCAATATGAGTAGTGACTAAAGCAGATTAATTTGA
TCAAATTAATCTGCTTTAGTCACTACTCATATTGGAACACTATTCCATGTATATACCTTGAGACAAATTCCAGGCCTGCTGATCGATTATGAATTGACCA[A/G]
CACATTTGGACTGTAGTGAAAATGATATCTCAGTCAATAAAAAAAGCCAACGTGTGAGAATAGCCGGTAAATTAGAACTAAACTGCACATAGATATTATA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 63.90% | 0.10% | 2.16% | 33.79% | NA |
| All Indica | 2759 | 48.50% | 0.20% | 2.97% | 48.39% | NA |
| All Japonica | 1512 | 97.50% | 0.00% | 0.26% | 2.25% | NA |
| Aus | 269 | 31.60% | 0.40% | 3.35% | 64.68% | NA |
| Indica I | 595 | 49.10% | 0.00% | 1.01% | 49.92% | NA |
| Indica II | 465 | 38.10% | 0.40% | 2.80% | 58.71% | NA |
| Indica III | 913 | 52.20% | 0.20% | 3.50% | 44.03% | NA |
| Indica Intermediate | 786 | 49.70% | 0.10% | 3.94% | 46.18% | NA |
| Temperate Japonica | 767 | 99.90% | 0.00% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 93.80% | 0.00% | 0.79% | 5.36% | NA |
| Japonica Intermediate | 241 | 97.50% | 0.00% | 0.00% | 2.49% | NA |
| VI/Aromatic | 96 | 55.20% | 0.00% | 4.17% | 40.62% | NA |
| Intermediate | 90 | 80.00% | 0.00% | 3.33% | 16.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0421189516 | T -> C | LOC_Os04g34890.1 | upstream_gene_variant ; 3420.0bp to feature; MODIFIER | silent_mutation | Average:8.166; most accessible tissue: Callus, score: 14.102 | N | N | N | N |
| vg0421189516 | T -> C | LOC_Os04g34890-LOC_Os04g34900 | intergenic_region ; MODIFIER | silent_mutation | Average:8.166; most accessible tissue: Callus, score: 14.102 | N | N | N | N |
| vg0421189516 | T -> DEL | N | N | silent_mutation | Average:8.166; most accessible tissue: Callus, score: 14.102 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0421189516 | 7.34E-06 | NA | mr1222_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421189516 | 3.44E-06 | NA | mr1222_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |