\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0421119918:

Variant ID: vg0421119918 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 21119918
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


TGAAATCCAAAAAAATTGTGGTATCCCTGTATACAGTAACCTCTGATTAACTCCCTGTATAATCTGACAATACTGAGGGACAAATGTAAGAGCATTTGCT[G/A]
GGATTTAATGAAATATTGGTTAGTTCTTGAGCTCGAATTGCTACCAAATCCCTAAACCCCTTTCTAAAATGCCACGGCACAGAGGTCATCACTGGCCTAC

Reverse complement sequence

GTAGGCCAGTGATGACCTCTGTGCCGTGGCATTTTAGAAAGGGGTTTAGGGATTTGGTAGCAATTCGAGCTCAAGAACTAACCAATATTTCATTAAATCC[C/T]
AGCAAATGCTCTTACATTTGTCCCTCAGTATTGTCAGATTATACAGGGAGTTAATCAGAGGTTACTGTATACAGGGATACCACAATTTTTTTGGATTTCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.40% 0.50% 1.48% 2.67% NA
All Indica  2759 95.80% 0.60% 1.45% 2.14% NA
All Japonica  1512 94.40% 0.20% 1.79% 3.64% NA
Aus  269 97.40% 0.70% 0.74% 1.12% NA
Indica I  595 95.80% 0.00% 1.85% 2.35% NA
Indica II  465 90.50% 1.10% 3.01% 5.38% NA
Indica III  913 98.70% 0.30% 0.11% 0.88% NA
Indica Intermediate  786 95.50% 1.10% 1.78% 1.53% NA
Temperate Japonica  767 98.30% 0.00% 0.26% 1.43% NA
Tropical Japonica  504 87.50% 0.60% 4.96% 6.94% NA
Japonica Intermediate  241 96.30% 0.00% 0.00% 3.73% NA
VI/Aromatic  96 94.80% 0.00% 0.00% 5.21% NA
Intermediate  90 94.40% 0.00% 1.11% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0421119918 G -> DEL N N silent_mutation Average:12.787; most accessible tissue: Minghui63 root, score: 25.504 N N N N
vg0421119918 G -> A LOC_Os04g34830.1 upstream_gene_variant ; 3324.0bp to feature; MODIFIER silent_mutation Average:12.787; most accessible tissue: Minghui63 root, score: 25.504 N N N N
vg0421119918 G -> A LOC_Os04g36550.1 upstream_gene_variant ; 3619.0bp to feature; MODIFIER silent_mutation Average:12.787; most accessible tissue: Minghui63 root, score: 25.504 N N N N
vg0421119918 G -> A LOC_Os04g34840.1 upstream_gene_variant ; 3619.0bp to feature; MODIFIER silent_mutation Average:12.787; most accessible tissue: Minghui63 root, score: 25.504 N N N N
vg0421119918 G -> A LOC_Os04g34830-LOC_Os04g36550 intergenic_region ; MODIFIER silent_mutation Average:12.787; most accessible tissue: Minghui63 root, score: 25.504 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0421119918 1.46E-06 NA mr1226_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421119918 3.24E-06 NA mr1246_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251