\
| Variant ID: vg0421084486 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 21084486 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
CTGCCGCACATATTTTGTAAATACCGGTTACTTTACACCTGAACTTCTTCCACGGTATGGAAAACTCCTGGTGTAAAAAGTTTAGGGTGTAAAGTAACCG[A/G]
TATTAGAGTTTAGTGGTGAAAATCGAATTACCGACATCAAACGTGGTCTTTGAAAGTTGAAATGTGGTTACTAAAAGTCATTAGCACTACTTTCTAAGAG
CTCTTAGAAAGTAGTGCTAATGACTTTTAGTAACCACATTTCAACTTTCAAAGACCACGTTTGATGTCGGTAATTCGATTTTCACCACTAAACTCTAATA[T/C]
CGGTTACTTTACACCCTAAACTTTTTACACCAGGAGTTTTCCATACCGTGGAAGAAGTTCAGGTGTAAAGTAACCGGTATTTACAAAATATGTGCGGCAG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.00% | 28.00% | 0.55% | 18.43% | NA |
| All Indica | 2759 | 30.20% | 37.90% | 0.91% | 31.03% | NA |
| All Japonica | 1512 | 98.10% | 1.70% | 0.00% | 0.26% | NA |
| Aus | 269 | 28.60% | 71.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 40.30% | 9.70% | 1.85% | 48.07% | NA |
| Indica II | 465 | 11.80% | 28.60% | 1.29% | 58.28% | NA |
| Indica III | 913 | 38.40% | 51.70% | 0.11% | 9.75% | NA |
| Indica Intermediate | 786 | 23.80% | 48.60% | 0.89% | 26.72% | NA |
| Temperate Japonica | 767 | 99.70% | 0.10% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 95.00% | 4.60% | 0.00% | 0.40% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.40% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 53.10% | 46.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 70.00% | 16.70% | 1.11% | 12.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0421084486 | A -> DEL | N | N | silent_mutation | Average:47.103; most accessible tissue: Callus, score: 74.385 | N | N | N | N |
| vg0421084486 | A -> G | LOC_Os04g34780-LOC_Os04g34800 | intergenic_region ; MODIFIER | silent_mutation | Average:47.103; most accessible tissue: Callus, score: 74.385 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0421084486 | NA | 1.65E-06 | mr1124 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421084486 | NA | 3.40E-06 | mr1202 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421084486 | NA | 7.65E-06 | mr1210 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421084486 | NA | 8.50E-06 | mr1305 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421084486 | NA | 5.45E-06 | mr1585 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421084486 | NA | 6.28E-06 | mr1592 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |