\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0421078392:

Variant ID: vg0421078392 (JBrowse)Variation Type: INDEL
Chromosome: chr04Position: 21078392
Reference Allele: CCTAlternative Allele: TCT,C,ACT
Primary Allele: CCTSecondary Allele: TCT

Inferred Ancestral Allele : CCT (evidence from allele frequency in Oryza rufipogon: CCT: 0.79, C: 0.20, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


CATGTAGTTTAAGTAAGTTGAGTGTCCTACTTGTTATACGCAGTTTTAGTTTGCTTAGAAAAAGAAAAGTTTGTCATTTATATCTTGACTAGAAAAAATG[CCT/TCT,C,ACT]
GTGTGTTGCGACGGGTGAATGCTATTTTAATCATATTATTGTTAAGATTTTTCTAAAAAGTACATCCTCCATTTCAAAATTATGACGCCATTGGCTTTTC

Reverse complement sequence

GAAAAGCCAATGGCGTCATAATTTTGAAATGGAGGATGTACTTTTTAGAAAAATCTTAACAATAATATGATTAAAATAGCATTCACCCGTCGCAACACAC[AGG/AGA,G,AGT]
CATTTTTTCTAGTCAAGATATAAATGACAAACTTTTCTTTTTCTAAGCAAACTAAAACTGCGTATAACAAGTAGGACACTCAACTTACTTAAACTACATG

Allele Frequencies:

Populations Population SizeFrequency of CCT(primary allele) Frequency of TCT(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.30% 38.30% 0.17% 0.00% C: 0.25%; ACT: 0.02%
All Indica  2759 37.10% 62.20% 0.29% 0.00% C: 0.43%; ACT: 0.04%
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 73.20% 26.80% 0.00% 0.00% NA
Indica I  595 42.40% 57.30% 0.34% 0.00% NA
Indica II  465 14.20% 85.20% 0.22% 0.00% C: 0.43%
Indica III  913 48.80% 51.20% 0.00% 0.00% NA
Indica Intermediate  786 33.00% 65.00% 0.64% 0.00% C: 1.27%; ACT: 0.13%
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 82.20% 17.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0421078392 CCT -> TCT LOC_Os04g34780.1 upstream_gene_variant ; 326.0bp to feature; MODIFIER silent_mutation Average:26.997; most accessible tissue: Zhenshan97 young leaf, score: 43.913 N N N N
vg0421078392 CCT -> TCT LOC_Os04g34780-LOC_Os04g34800 intergenic_region ; MODIFIER silent_mutation Average:26.997; most accessible tissue: Zhenshan97 young leaf, score: 43.913 N N N N
vg0421078392 CCT -> C LOC_Os04g34780.1 upstream_gene_variant ; 327.0bp to feature; MODIFIER silent_mutation Average:26.997; most accessible tissue: Zhenshan97 young leaf, score: 43.913 N N N N
vg0421078392 CCT -> C LOC_Os04g34780-LOC_Os04g34800 intergenic_region ; MODIFIER silent_mutation Average:26.997; most accessible tissue: Zhenshan97 young leaf, score: 43.913 N N N N
vg0421078392 CCT -> ACT LOC_Os04g34780.1 upstream_gene_variant ; 326.0bp to feature; MODIFIER silent_mutation Average:26.997; most accessible tissue: Zhenshan97 young leaf, score: 43.913 N N N N
vg0421078392 CCT -> ACT LOC_Os04g34780-LOC_Os04g34800 intergenic_region ; MODIFIER silent_mutation Average:26.997; most accessible tissue: Zhenshan97 young leaf, score: 43.913 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0421078392 NA 1.90E-06 mr1182 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421078392 NA 6.26E-10 mr1352 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421078392 NA 3.75E-12 mr1138_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421078392 NA 1.43E-09 mr1158_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421078392 NA 1.26E-08 mr1167_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421078392 NA 1.45E-08 mr1172_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421078392 5.16E-06 2.06E-06 mr1182_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421078392 NA 3.93E-06 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421078392 8.55E-06 6.77E-07 mr1185_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421078392 2.20E-06 2.20E-06 mr1282_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421078392 NA 4.17E-06 mr1291_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421078392 NA 2.52E-06 mr1329_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421078392 NA 7.24E-06 mr1397_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421078392 NA 2.16E-06 mr1479_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421078392 NA 3.40E-06 mr1502_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421078392 NA 1.24E-06 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421078392 1.13E-06 3.78E-09 mr1549_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421078392 NA 5.37E-23 mr1551_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421078392 NA 1.50E-13 mr1552_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421078392 NA 3.26E-21 mr1627_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421078392 NA 2.66E-07 mr1653_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421078392 NA 2.12E-07 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421078392 NA 3.55E-06 mr1733_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421078392 1.61E-06 4.43E-07 mr1757_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421078392 NA 4.16E-07 mr1892_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421078392 1.27E-06 1.27E-06 mr1919_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421078392 3.51E-06 NA mr1950_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421078392 6.76E-07 5.58E-09 mr1950_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251