| Variant ID: vg0421072935 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 21072935 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
AAAGTTTACATACCCGATTCAAATTTGAATTTGAATTATATCTGATTTAAATTTGAATTTGAATTCTATATATAGTATTTTTATGCATCTAAAGTTTATA[C/G]
ACCTAAAGTTTATAGACCTAAAGTTTATAAGTCAAAAGTTTACATACCCGATTCAAATTTAAATTTGAATTATATCCGATTCAAATTTGAATTTAAATTC
GAATTTAAATTCAAATTTGAATCGGATATAATTCAAATTTAAATTTGAATCGGGTATGTAAACTTTTGACTTATAAACTTTAGGTCTATAAACTTTAGGT[G/C]
TATAAACTTTAGATGCATAAAAATACTATATATAGAATTCAAATTCAAATTTAAATCAGATATAATTCAAATTCAAATTTGAATCGGGTATGTAAACTTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.60% | 6.50% | 10.96% | 25.90% | NA |
| All Indica | 2759 | 35.20% | 8.70% | 12.72% | 43.31% | NA |
| All Japonica | 1512 | 98.30% | 0.10% | 1.46% | 0.20% | NA |
| Aus | 269 | 32.70% | 23.00% | 39.41% | 4.83% | NA |
| Indica I | 595 | 44.20% | 2.00% | 2.52% | 51.26% | NA |
| Indica II | 465 | 13.30% | 5.80% | 9.25% | 71.61% | NA |
| Indica III | 913 | 45.10% | 13.90% | 18.95% | 22.02% | NA |
| Indica Intermediate | 786 | 29.90% | 9.50% | 15.27% | 45.29% | NA |
| Temperate Japonica | 767 | 99.70% | 0.00% | 0.00% | 0.26% | NA |
| Tropical Japonica | 504 | 95.40% | 0.20% | 4.17% | 0.20% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 60.40% | 2.10% | 37.50% | 0.00% | NA |
| Intermediate | 90 | 80.00% | 2.20% | 3.33% | 14.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0421072935 | C -> DEL | N | N | silent_mutation | Average:8.595; most accessible tissue: Minghui63 panicle, score: 16.27 | N | N | N | N |
| vg0421072935 | C -> G | LOC_Os04g34780.1 | downstream_gene_variant ; 4171.0bp to feature; MODIFIER | silent_mutation | Average:8.595; most accessible tissue: Minghui63 panicle, score: 16.27 | N | N | N | N |
| vg0421072935 | C -> G | LOC_Os04g34760-LOC_Os04g34780 | intergenic_region ; MODIFIER | silent_mutation | Average:8.595; most accessible tissue: Minghui63 panicle, score: 16.27 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0421072935 | NA | 3.20E-06 | Awn_length | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0421072935 | 2.29E-06 | NA | mr1888 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421072935 | NA | 5.21E-07 | mr1074_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421072935 | NA | 2.38E-06 | mr1148_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421072935 | NA | 7.46E-06 | mr1150_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |