\
| Variant ID: vg0421072597 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 21072597 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.93, C: 0.07, others allele: 0.00, population size: 96. )
TCGGCGATCGATCGCCTGGGATGGGGGTAGCGATCAATTCCCCTCCCCCTCCCTCCCTCCACTGGTTTCCTTTTTTGGCACCGCATTACTTTCTTATTTT[C/A]
GTAAATTTATGCACCTAAAGTTTATACACCTCAAGTTTACACATATAAAGTTTAAAGACCCAAAGTTTACACATATAAAGTTTAGAGACCCAAAGTTTAC
GTAAACTTTGGGTCTCTAAACTTTATATGTGTAAACTTTGGGTCTTTAAACTTTATATGTGTAAACTTGAGGTGTATAAACTTTAGGTGCATAAATTTAC[G/T]
AAAATAAGAAAGTAATGCGGTGCCAAAAAAGGAAACCAGTGGAGGGAGGGAGGGGGAGGGGAATTGATCGCTACCCCCATCCCAGGCGATCGATCGCCGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.20% | 21.40% | 2.12% | 23.23% | NA |
| All Indica | 2759 | 30.20% | 27.90% | 2.61% | 39.33% | NA |
| All Japonica | 1512 | 98.30% | 1.50% | 0.13% | 0.13% | NA |
| Aus | 269 | 28.30% | 62.50% | 8.92% | 0.37% | NA |
| Indica I | 595 | 40.20% | 7.60% | 0.67% | 51.60% | NA |
| Indica II | 465 | 12.30% | 20.20% | 2.58% | 64.95% | NA |
| Indica III | 913 | 38.10% | 39.50% | 2.30% | 20.04% | NA |
| Indica Intermediate | 786 | 24.00% | 34.20% | 4.45% | 37.28% | NA |
| Temperate Japonica | 767 | 99.70% | 0.00% | 0.13% | 0.13% | NA |
| Tropical Japonica | 504 | 95.40% | 4.20% | 0.20% | 0.20% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 54.20% | 44.80% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 76.70% | 11.10% | 1.11% | 11.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0421072597 | C -> DEL | N | N | silent_mutation | Average:14.391; most accessible tissue: Minghui63 panicle, score: 38.588 | N | N | N | N |
| vg0421072597 | C -> A | LOC_Os04g34780.1 | downstream_gene_variant ; 4509.0bp to feature; MODIFIER | silent_mutation | Average:14.391; most accessible tissue: Minghui63 panicle, score: 38.588 | N | N | N | N |
| vg0421072597 | C -> A | LOC_Os04g34760-LOC_Os04g34780 | intergenic_region ; MODIFIER | silent_mutation | Average:14.391; most accessible tissue: Minghui63 panicle, score: 38.588 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0421072597 | 9.44E-07 | NA | mr1202 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421072597 | 2.07E-06 | 9.37E-07 | mr1202 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421072597 | NA | 1.75E-09 | mr1322 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421072597 | 6.31E-06 | NA | mr1343 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421072597 | NA | 9.46E-06 | mr1407 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421072597 | NA | 8.98E-06 | mr1424 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421072597 | NA | 7.97E-06 | mr1569 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421072597 | NA | 8.95E-07 | mr1574 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421072597 | 9.02E-07 | 9.02E-07 | mr1770 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |