\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0421072597:

Variant ID: vg0421072597 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 21072597
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.93, C: 0.07, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:


TCGGCGATCGATCGCCTGGGATGGGGGTAGCGATCAATTCCCCTCCCCCTCCCTCCCTCCACTGGTTTCCTTTTTTGGCACCGCATTACTTTCTTATTTT[C/A]
GTAAATTTATGCACCTAAAGTTTATACACCTCAAGTTTACACATATAAAGTTTAAAGACCCAAAGTTTACACATATAAAGTTTAGAGACCCAAAGTTTAC

Reverse complement sequence

GTAAACTTTGGGTCTCTAAACTTTATATGTGTAAACTTTGGGTCTTTAAACTTTATATGTGTAAACTTGAGGTGTATAAACTTTAGGTGCATAAATTTAC[G/T]
AAAATAAGAAAGTAATGCGGTGCCAAAAAAGGAAACCAGTGGAGGGAGGGAGGGGGAGGGGAATTGATCGCTACCCCCATCCCAGGCGATCGATCGCCGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.20% 21.40% 2.12% 23.23% NA
All Indica  2759 30.20% 27.90% 2.61% 39.33% NA
All Japonica  1512 98.30% 1.50% 0.13% 0.13% NA
Aus  269 28.30% 62.50% 8.92% 0.37% NA
Indica I  595 40.20% 7.60% 0.67% 51.60% NA
Indica II  465 12.30% 20.20% 2.58% 64.95% NA
Indica III  913 38.10% 39.50% 2.30% 20.04% NA
Indica Intermediate  786 24.00% 34.20% 4.45% 37.28% NA
Temperate Japonica  767 99.70% 0.00% 0.13% 0.13% NA
Tropical Japonica  504 95.40% 4.20% 0.20% 0.20% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 54.20% 44.80% 1.04% 0.00% NA
Intermediate  90 76.70% 11.10% 1.11% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0421072597 C -> DEL N N silent_mutation Average:14.391; most accessible tissue: Minghui63 panicle, score: 38.588 N N N N
vg0421072597 C -> A LOC_Os04g34780.1 downstream_gene_variant ; 4509.0bp to feature; MODIFIER silent_mutation Average:14.391; most accessible tissue: Minghui63 panicle, score: 38.588 N N N N
vg0421072597 C -> A LOC_Os04g34760-LOC_Os04g34780 intergenic_region ; MODIFIER silent_mutation Average:14.391; most accessible tissue: Minghui63 panicle, score: 38.588 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0421072597 9.44E-07 NA mr1202 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421072597 2.07E-06 9.37E-07 mr1202 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421072597 NA 1.75E-09 mr1322 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421072597 6.31E-06 NA mr1343 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421072597 NA 9.46E-06 mr1407 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421072597 NA 8.98E-06 mr1424 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421072597 NA 7.97E-06 mr1569 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421072597 NA 8.95E-07 mr1574 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421072597 9.02E-07 9.02E-07 mr1770 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251