\
| Variant ID: vg0421062242 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 21062242 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.82, T: 0.17, others allele: 0.00, population size: 99. )
ATTTTTCTCATAGTCAAACTTGTCTAAGTTTGATCAAATTTACATAAAAGCGAAATAATATTTTTAACACAAAACAAATATATTATCAAAATATATTCAA[T/C]
ATTAAATTTAATGAAAAAATGTTTTAGAAGTTGCGAACTTAGCTGACTTATAATATAAAACGGCAGAACTACCTGTAAGGATCGGTGTGCATGCAGTCGC
GCGACTGCATGCACACCGATCCTTACAGGTAGTTCTGCCGTTTTATATTATAAGTCAGCTAAGTTCGCAACTTCTAAAACATTTTTTCATTAAATTTAAT[A/G]
TTGAATATATTTTGATAATATATTTGTTTTGTGTTAAAAATATTATTTCGCTTTTATGTAAATTTGATCAAACTTAGACAAGTTTGACTATGAGAAAAAT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.90% | 47.40% | 0.72% | 0.00% | NA |
| All Indica | 2759 | 28.10% | 70.80% | 1.12% | 0.00% | NA |
| All Japonica | 1512 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Aus | 269 | 28.60% | 71.00% | 0.37% | 0.00% | NA |
| Indica I | 595 | 37.80% | 61.50% | 0.67% | 0.00% | NA |
| Indica II | 465 | 10.10% | 89.20% | 0.65% | 0.00% | NA |
| Indica III | 913 | 35.70% | 62.10% | 2.19% | 0.00% | NA |
| Indica Intermediate | 786 | 22.50% | 77.00% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 95.40% | 4.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 55.20% | 43.80% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 71.10% | 27.80% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0421062242 | T -> C | LOC_Os04g34760.1 | upstream_gene_variant ; 3613.0bp to feature; MODIFIER | silent_mutation | Average:44.458; most accessible tissue: Callus, score: 86.288 | N | N | N | N |
| vg0421062242 | T -> C | LOC_Os04g34760-LOC_Os04g34780 | intergenic_region ; MODIFIER | silent_mutation | Average:44.458; most accessible tissue: Callus, score: 86.288 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0421062242 | NA | 2.37E-10 | mr1011_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421062242 | 1.30E-06 | 1.95E-08 | mr1011_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421062242 | NA | 1.72E-07 | mr1015_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421062242 | NA | 2.63E-06 | mr1031_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421062242 | NA | 4.57E-06 | mr1158_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421062242 | NA | 3.29E-07 | mr1167_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421062242 | NA | 7.01E-07 | mr1184_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421062242 | NA | 3.68E-06 | mr1184_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421062242 | NA | 5.66E-06 | mr1278_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421062242 | NA | 3.39E-07 | mr1329_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421062242 | NA | 3.24E-18 | mr1336_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421062242 | NA | 1.63E-06 | mr1397_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421062242 | NA | 3.77E-07 | mr1524_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421062242 | NA | 8.03E-07 | mr1549_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421062242 | NA | 2.28E-17 | mr1579_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421062242 | NA | 1.22E-11 | mr1636_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421062242 | NA | 1.59E-06 | mr1641_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421062242 | NA | 1.32E-17 | mr1682_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421062242 | NA | 5.93E-10 | mr1683_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421062242 | 8.20E-06 | 3.07E-08 | mr1683_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421062242 | NA | 7.78E-06 | mr1687_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421062242 | NA | 6.06E-06 | mr1808_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421062242 | 3.11E-06 | 3.10E-06 | mr1812_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421062242 | 8.28E-06 | 8.28E-06 | mr1832_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421062242 | 6.27E-06 | 6.27E-06 | mr1833_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421062242 | NA | 2.39E-13 | mr1838_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421062242 | NA | 2.93E-07 | mr1838_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421062242 | NA | 3.43E-07 | mr1950_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421062242 | NA | 1.93E-06 | mr1982_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421062242 | 5.65E-06 | 5.64E-06 | mr1983_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |