\
| Variant ID: vg0421061649 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 21061649 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 254. )
CAACAATGCAACATGCGCATTATAGGCTTGAGAGGCATCTAGAGCTCTGTTTCAGCCACCTCATTATATTCTTGTTACCGTGATCCCTGAAGCAAGTGAC[C/G]
ACCAGATATCGACAATTCAACCCCAGTCCAGGGTTGTTTTCCGGTGTCTTTTGTGTACCACACCGTCACGTTCATGTGTTACCTCTCCTGCCTTAGTACT
AGTACTAAGGCAGGAGAGGTAACACATGAACGTGACGGTGTGGTACACAAAAGACACCGGAAAACAACCCTGGACTGGGGTTGAATTGTCGATATCTGGT[G/C]
GTCACTTGCTTCAGGGATCACGGTAACAAGAATATAATGAGGTGGCTGAAACAGAGCTCTAGATGCCTCTCAAGCCTATAATGCGCATGTTGCATTGTTG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 85.80% | 11.90% | 2.26% | 0.00% | NA |
| All Indica | 2759 | 97.60% | 1.30% | 1.05% | 0.00% | NA |
| All Japonica | 1512 | 66.50% | 28.80% | 4.70% | 0.00% | NA |
| Aus | 269 | 71.70% | 26.80% | 1.49% | 0.00% | NA |
| Indica I | 595 | 98.50% | 0.00% | 1.51% | 0.00% | NA |
| Indica II | 465 | 97.80% | 1.90% | 0.22% | 0.00% | NA |
| Indica III | 913 | 96.80% | 1.40% | 1.75% | 0.00% | NA |
| Indica Intermediate | 786 | 97.70% | 1.90% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 87.50% | 6.80% | 5.74% | 0.00% | NA |
| Tropical Japonica | 504 | 35.10% | 61.90% | 2.98% | 0.00% | NA |
| Japonica Intermediate | 241 | 65.60% | 29.50% | 4.98% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 75.60% | 21.10% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0421061649 | C -> G | LOC_Os04g34760.1 | upstream_gene_variant ; 3020.0bp to feature; MODIFIER | silent_mutation | Average:48.453; most accessible tissue: Zhenshan97 young leaf, score: 75.397 | N | N | N | N |
| vg0421061649 | C -> G | LOC_Os04g34760-LOC_Os04g34780 | intergenic_region ; MODIFIER | silent_mutation | Average:48.453; most accessible tissue: Zhenshan97 young leaf, score: 75.397 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0421061649 | NA | 5.48E-08 | mr1029 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421061649 | NA | 8.29E-11 | mr1047 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421061649 | NA | 6.24E-08 | mr1189 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421061649 | NA | 6.40E-07 | mr1271 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421061649 | NA | 7.38E-06 | mr1295 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421061649 | NA | 5.10E-08 | mr1625 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421061649 | NA | 3.01E-08 | mr1642 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421061649 | NA | 2.52E-06 | mr1725 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421061649 | NA | 5.96E-07 | mr1782 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421061649 | NA | 1.90E-07 | mr1796 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421061649 | 4.65E-06 | 1.58E-09 | mr1990 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421061649 | NA | 6.31E-12 | mr1047_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421061649 | NA | 3.24E-12 | mr1189_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421061649 | NA | 8.48E-10 | mr1338_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421061649 | NA | 8.20E-09 | mr1449_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421061649 | NA | 4.34E-09 | mr1471_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421061649 | NA | 7.61E-10 | mr1642_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421061649 | NA | 4.83E-07 | mr1696_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421061649 | NA | 2.56E-06 | mr1815_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421061649 | NA | 1.44E-07 | mr1819_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421061649 | NA | 1.25E-06 | mr1966_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |