Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0421038480:

Variant ID: vg0421038480 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 21038480
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TAGCCAGCGAAGTACTAGCATGGAGAGGAGAAAACCCGAGCGAGCTCAGTGGCTCTAGTCCATCTCGCTGATCGGTGGCGCTCCTTCGCACGCACTGCTC[A/G]
TTGGCCACCACCACCAATCACTGGGATGTGTCGCCAATATTGATTCTAGATCCAAAATGAAAAGGAAAATTCAAGTGAAAGAGAGTAAATGGTTGGTCGG

Reverse complement sequence

CCGACCAACCATTTACTCTCTTTCACTTGAATTTTCCTTTTCATTTTGGATCTAGAATCAATATTGGCGACACATCCCAGTGATTGGTGGTGGTGGCCAA[T/C]
GAGCAGTGCGTGCGAAGGAGCGCCACCGATCAGCGAGATGGACTAGAGCCACTGAGCTCGCTCGGGTTTTCTCCTCTCCATGCTAGTACTTCGCTGGCTA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	54.00%	5.90%	1.31%	38.72%	NA
All Indica	2759	31.20%	4.20%	2.10%	62.49%	NA
All Japonica	1512	98.10%	0.30%	0.00%	1.59%	NA
Aus	269	31.20%	53.20%	0.74%	14.87%	NA
Indica I	595	41.80%	0.00%	1.51%	56.64%	NA
Indica II	465	14.00%	1.90%	2.15%	81.94%	NA
Indica III	913	37.80%	5.60%	2.74%	53.89%	NA
Indica Intermediate	786	25.80%	7.00%	1.78%	65.39%	NA
Temperate Japonica	767	99.70%	0.00%	0.00%	0.26%	NA
Tropical Japonica	504	95.40%	0.40%	0.00%	4.17%	NA
Japonica Intermediate	241	98.80%	0.80%	0.00%	0.41%	NA
VI/Aromatic	96	57.30%	12.50%	0.00%	30.21%	NA
Intermediate	90	76.70%	6.70%	2.22%	14.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0421038480	A -> DEL	N	N	silent_mutation	Average:12.843; most accessible tissue: Callus, score: 72.964	N	N	N	N
vg0421038480	A -> G	LOC_Os04g34690.1	downstream_gene_variant ; 2219.0bp to feature; MODIFIER	silent_mutation	Average:12.843; most accessible tissue: Callus, score: 72.964	N	N	N	N
vg0421038480	A -> G	LOC_Os04g34740.1	downstream_gene_variant ; 2941.0bp to feature; MODIFIER	silent_mutation	Average:12.843; most accessible tissue: Callus, score: 72.964	N	N	N	N
vg0421038480	A -> G	LOC_Os04g34690-LOC_Os04g34740	intergenic_region ; MODIFIER	silent_mutation	Average:12.843; most accessible tissue: Callus, score: 72.964	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0421038480	NA	4.85E-06	mr1015_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421038480	1.00E-06	2.96E-07	mr1158_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421038480	2.02E-06	4.63E-09	mr1158_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421038480	NA	1.12E-08	mr1172_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421038480	NA	6.44E-08	mr1184_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421038480	NA	1.61E-06	mr1184_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421038480	NA	6.53E-06	mr1265_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421038480	NA	1.07E-06	mr1278_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421038480	NA	1.66E-07	mr1329_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421038480	NA	9.89E-06	mr1373_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421038480	NA	7.15E-07	mr1397_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421038480	NA	8.54E-08	mr1524_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421038480	9.56E-06	4.00E-07	mr1549_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421038480	NA	6.15E-16	mr1579_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421038480	NA	9.21E-10	mr1683_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421038480	NA	8.19E-08	mr1683_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421038480	5.57E-06	5.57E-06	mr1812_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421038480	8.58E-06	8.58E-06	mr1832_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421038480	8.60E-06	8.60E-06	mr1833_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421038480	NA	6.96E-07	mr1950_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421038480	NA	3.74E-06	mr1982_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421038480	3.10E-06	3.10E-06	mr1983_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251