\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0421038480:

Variant ID: vg0421038480 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 21038480
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAGCCAGCGAAGTACTAGCATGGAGAGGAGAAAACCCGAGCGAGCTCAGTGGCTCTAGTCCATCTCGCTGATCGGTGGCGCTCCTTCGCACGCACTGCTC[A/G]
TTGGCCACCACCACCAATCACTGGGATGTGTCGCCAATATTGATTCTAGATCCAAAATGAAAAGGAAAATTCAAGTGAAAGAGAGTAAATGGTTGGTCGG

Reverse complement sequence

CCGACCAACCATTTACTCTCTTTCACTTGAATTTTCCTTTTCATTTTGGATCTAGAATCAATATTGGCGACACATCCCAGTGATTGGTGGTGGTGGCCAA[T/C]
GAGCAGTGCGTGCGAAGGAGCGCCACCGATCAGCGAGATGGACTAGAGCCACTGAGCTCGCTCGGGTTTTCTCCTCTCCATGCTAGTACTTCGCTGGCTA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.00% 5.90% 1.31% 38.72% NA
All Indica  2759 31.20% 4.20% 2.10% 62.49% NA
All Japonica  1512 98.10% 0.30% 0.00% 1.59% NA
Aus  269 31.20% 53.20% 0.74% 14.87% NA
Indica I  595 41.80% 0.00% 1.51% 56.64% NA
Indica II  465 14.00% 1.90% 2.15% 81.94% NA
Indica III  913 37.80% 5.60% 2.74% 53.89% NA
Indica Intermediate  786 25.80% 7.00% 1.78% 65.39% NA
Temperate Japonica  767 99.70% 0.00% 0.00% 0.26% NA
Tropical Japonica  504 95.40% 0.40% 0.00% 4.17% NA
Japonica Intermediate  241 98.80% 0.80% 0.00% 0.41% NA
VI/Aromatic  96 57.30% 12.50% 0.00% 30.21% NA
Intermediate  90 76.70% 6.70% 2.22% 14.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0421038480 A -> DEL N N silent_mutation Average:12.843; most accessible tissue: Callus, score: 72.964 N N N N
vg0421038480 A -> G LOC_Os04g34690.1 downstream_gene_variant ; 2219.0bp to feature; MODIFIER silent_mutation Average:12.843; most accessible tissue: Callus, score: 72.964 N N N N
vg0421038480 A -> G LOC_Os04g34740.1 downstream_gene_variant ; 2941.0bp to feature; MODIFIER silent_mutation Average:12.843; most accessible tissue: Callus, score: 72.964 N N N N
vg0421038480 A -> G LOC_Os04g34690-LOC_Os04g34740 intergenic_region ; MODIFIER silent_mutation Average:12.843; most accessible tissue: Callus, score: 72.964 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0421038480 NA 4.85E-06 mr1015_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421038480 1.00E-06 2.96E-07 mr1158_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421038480 2.02E-06 4.63E-09 mr1158_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421038480 NA 1.12E-08 mr1172_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421038480 NA 6.44E-08 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421038480 NA 1.61E-06 mr1184_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421038480 NA 6.53E-06 mr1265_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421038480 NA 1.07E-06 mr1278_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421038480 NA 1.66E-07 mr1329_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421038480 NA 9.89E-06 mr1373_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421038480 NA 7.15E-07 mr1397_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421038480 NA 8.54E-08 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421038480 9.56E-06 4.00E-07 mr1549_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421038480 NA 6.15E-16 mr1579_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421038480 NA 9.21E-10 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421038480 NA 8.19E-08 mr1683_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421038480 5.57E-06 5.57E-06 mr1812_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421038480 8.58E-06 8.58E-06 mr1832_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421038480 8.60E-06 8.60E-06 mr1833_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421038480 NA 6.96E-07 mr1950_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421038480 NA 3.74E-06 mr1982_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421038480 3.10E-06 3.10E-06 mr1983_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251