\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0421026153:

Variant ID: vg0421026153 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 21026153
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, A: 0.03, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:


CGTTTTTCAAAAAAATTCCGAAATTTCGGTACATTTTTTGACATAACTATTTGAAAATATAACAAATTTTGAAGGAGAAATATAACAAACTTTTTTTTGA[A/C]
AAATTTTGAACAAAAATGTTTGAAAAAAATGCACATTGTTCTACGGAAGATAAACTATTCGAAATGTACATTTTTCATCTTATTATTCTTGTTTACAAAT

Reverse complement sequence

ATTTGTAAACAAGAATAATAAGATGAAAAATGTACATTTCGAATAGTTTATCTTCCGTAGAACAATGTGCATTTTTTTCAAACATTTTTGTTCAAAATTT[T/G]
TCAAAAAAAAGTTTGTTATATTTCTCCTTCAAAATTTGTTATATTTTCAAATAGTTATGTCAAAAAATGTACCGAAATTTCGGAATTTTTTTGAAAAACG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.60% 48.90% 0.55% 1.04% NA
All Indica  2759 76.10% 23.10% 0.62% 0.22% NA
All Japonica  1512 0.50% 98.20% 0.13% 1.12% NA
Aus  269 72.50% 27.50% 0.00% 0.00% NA
Indica I  595 74.80% 23.50% 1.68% 0.00% NA
Indica II  465 89.20% 9.90% 0.43% 0.43% NA
Indica III  913 66.20% 33.40% 0.33% 0.11% NA
Indica Intermediate  786 80.90% 18.40% 0.25% 0.38% NA
Temperate Japonica  767 0.40% 99.60% 0.00% 0.00% NA
Tropical Japonica  504 0.80% 95.60% 0.40% 3.17% NA
Japonica Intermediate  241 0.40% 99.20% 0.00% 0.41% NA
VI/Aromatic  96 13.50% 56.20% 3.12% 27.08% NA
Intermediate  90 28.90% 66.70% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0421026153 A -> C LOC_Os04g34700.1 downstream_gene_variant ; 3400.0bp to feature; MODIFIER silent_mutation Average:29.698; most accessible tissue: Minghui63 panicle, score: 38.588 N N N N
vg0421026153 A -> C LOC_Os04g34700-LOC_Os04g34690 intergenic_region ; MODIFIER silent_mutation Average:29.698; most accessible tissue: Minghui63 panicle, score: 38.588 N N N N
vg0421026153 A -> DEL N N silent_mutation Average:29.698; most accessible tissue: Minghui63 panicle, score: 38.588 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0421026153 NA 3.07E-06 mr1011_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421026153 NA 2.54E-07 mr1030_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421026153 NA 6.97E-07 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421026153 NA 4.14E-07 mr1184_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421026153 1.90E-06 1.90E-06 mr1267_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421026153 NA 4.02E-06 mr1278_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421026153 NA 1.69E-06 mr1278_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421026153 NA 8.15E-20 mr1281_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421026153 7.78E-06 7.78E-06 mr1284_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421026153 4.80E-06 4.80E-06 mr1311_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421026153 6.98E-06 6.98E-06 mr1312_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421026153 1.05E-06 4.44E-09 mr1329_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421026153 3.04E-07 3.04E-07 mr1329_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421026153 NA 2.48E-06 mr1337_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421026153 8.93E-06 8.93E-06 mr1337_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421026153 NA 7.89E-18 mr1342_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421026153 NA 9.79E-06 mr1373_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421026153 6.90E-07 6.90E-07 mr1374_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421026153 NA 1.32E-09 mr1379_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421026153 NA 7.14E-06 mr1391_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421026153 NA 4.76E-07 mr1397_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421026153 7.22E-06 1.73E-08 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421026153 6.12E-07 6.12E-07 mr1524_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421026153 NA 1.72E-06 mr1549_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421026153 NA 1.11E-15 mr1578_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421026153 NA 6.67E-17 mr1579_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421026153 2.65E-06 2.65E-06 mr1663_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421026153 3.20E-06 3.20E-06 mr1674_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421026153 NA 8.01E-09 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421026153 3.41E-06 3.79E-08 mr1683_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421026153 1.83E-06 1.83E-06 mr1687_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421026153 1.54E-06 1.54E-06 mr1688_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421026153 NA 3.80E-08 mr1690_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421026153 2.72E-06 2.72E-06 mr1697_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421026153 NA 5.04E-23 mr1708_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421026153 NA 5.42E-14 mr1713_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421026153 NA 2.76E-07 mr1749_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421026153 NA 7.28E-07 mr1754_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421026153 9.24E-06 9.24E-06 mr1760_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421026153 NA 3.69E-06 mr1766_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421026153 NA 5.15E-08 mr1783_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421026153 NA 1.80E-07 mr1804_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421026153 1.11E-06 1.11E-06 mr1812_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421026153 NA 1.54E-07 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421026153 5.10E-07 5.10E-07 mr1832_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421026153 2.81E-06 2.81E-06 mr1833_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421026153 8.45E-07 8.45E-07 mr1843_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421026153 1.26E-06 1.26E-06 mr1847_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421026153 3.68E-07 5.84E-09 mr1982_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421026153 6.44E-06 6.44E-06 mr1982_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251