\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0421026126:

Variant ID: vg0421026126 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 21026126
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.91, A: 0.09, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:


ATTGACCGAGCACAGGGTTTACACTTTCGTTTTTCAAAAAAATTCCGAAATTTCGGTACATTTTTTGACATAACTATTTGAAAATATAACAAATTTTGAA[G/A]
GAGAAATATAACAAACTTTTTTTTGAAAAATTTTGAACAAAAATGTTTGAAAAAAATGCACATTGTTCTACGGAAGATAAACTATTCGAAATGTACATTT

Reverse complement sequence

AAATGTACATTTCGAATAGTTTATCTTCCGTAGAACAATGTGCATTTTTTTCAAACATTTTTGTTCAAAATTTTTCAAAAAAAAGTTTGTTATATTTCTC[C/T]
TTCAAAATTTGTTATATTTTCAAATAGTTATGTCAAAAAATGTACCGAAATTTCGGAATTTTTTTGAAAAACGAAAGTGTAAACCCTGTGCTCGGTCAAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.70% 46.00% 0.28% 0.99% NA
All Indica  2759 28.90% 70.80% 0.25% 0.11% NA
All Japonica  1512 98.40% 0.30% 0.07% 1.19% NA
Aus  269 31.60% 68.00% 0.37% 0.00% NA
Indica I  595 28.40% 71.40% 0.17% 0.00% NA
Indica II  465 13.10% 86.70% 0.22% 0.00% NA
Indica III  913 40.40% 59.40% 0.22% 0.00% NA
Indica Intermediate  786 25.10% 74.20% 0.38% 0.38% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 95.80% 0.60% 0.20% 3.37% NA
Japonica Intermediate  241 99.60% 0.00% 0.00% 0.41% NA
VI/Aromatic  96 58.30% 11.50% 3.12% 27.08% NA
Intermediate  90 74.40% 24.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0421026126 G -> DEL N N silent_mutation Average:30.599; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N
vg0421026126 G -> A LOC_Os04g34700.1 downstream_gene_variant ; 3373.0bp to feature; MODIFIER silent_mutation Average:30.599; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N
vg0421026126 G -> A LOC_Os04g34700-LOC_Os04g34690 intergenic_region ; MODIFIER silent_mutation Average:30.599; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0421026126 5.55E-06 4.62E-08 mr1030_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421026126 NA 2.03E-06 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421026126 2.93E-06 NA mr1049_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421026126 NA 6.04E-12 mr1138_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421026126 NA 1.85E-06 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421026126 NA 7.86E-06 mr1184_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421026126 4.26E-06 4.26E-06 mr1267_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421026126 NA 3.07E-18 mr1281_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421026126 2.02E-06 4.93E-09 mr1329_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421026126 1.91E-06 1.91E-06 mr1329_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421026126 3.55E-06 6.43E-07 mr1337_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421026126 NA 1.57E-16 mr1342_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421026126 3.11E-06 NA mr1344_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421026126 2.42E-06 2.37E-07 mr1391_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421026126 NA 3.48E-06 mr1397_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421026126 7.69E-06 1.49E-08 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421026126 1.78E-06 1.78E-06 mr1524_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421026126 NA 1.55E-06 mr1549_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421026126 NA 1.00E-23 mr1551_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421026126 NA 3.49E-13 mr1552_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421026126 NA 1.46E-06 mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421026126 NA 2.41E-16 mr1578_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421026126 8.71E-06 8.71E-06 mr1674_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421026126 NA 1.58E-07 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421026126 NA 8.95E-06 mr1683_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421026126 9.18E-06 9.18E-06 mr1688_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421026126 NA 7.45E-23 mr1708_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421026126 NA 2.47E-14 mr1713_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421026126 NA 1.15E-07 mr1749_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421026126 NA 7.20E-07 mr1754_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421026126 2.46E-06 2.24E-07 mr1757_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421026126 NA 1.26E-09 mr1783_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421026126 NA 8.23E-09 mr1804_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421026126 NA 9.38E-09 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421026126 NA 3.30E-06 mr1852_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421026126 NA 6.71E-14 mr1938_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421026126 4.70E-06 NA mr1952_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421026126 8.97E-08 1.38E-09 mr1982_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421026126 1.89E-06 1.89E-06 mr1982_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251