Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0421022965:

Variant ID: vg0421022965 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 21022965
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCAACTAACTAAACACAGTCTTCTTTGACGCTGGATGAGACTAAAGCCGGAGGCTATAGATCGACTTAGTTTGTGACGTCTCTTTGTTAGGGATTAAGTG[G/A]
TACAGAACCGACAAAATTTCTAGACCTTAGTTATTAGGTTCTGCATTTAAGATTAATTACTGGGCAGAAGATCTTGCATCTTACTCAAAGAAACTGTACC

Reverse complement sequence

GGTACAGTTTCTTTGAGTAAGATGCAAGATCTTCTGCCCAGTAATTAATCTTAAATGCAGAACCTAATAACTAAGGTCTAGAAATTTTGTCGGTTCTGTA[C/T]
CACTTAATCCCTAACAAAGAGACGTCACAAACTAAGTCGATCTATAGCCTCCGGCTTTAGTCTCATCCAGCGTCAAAGAAGACTGTGTTTAGTTAGTTGG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.20%	5.20%	0.61%	0.99%	NA
All Indica	2759	99.30%	0.50%	0.07%	0.11%	NA
All Japonica	1512	82.90%	14.40%	1.59%	1.19%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	98.50%	1.50%	0.00%	0.00%	NA
Indica III	913	99.90%	0.00%	0.11%	0.00%	NA
Indica Intermediate	786	98.70%	0.80%	0.13%	0.38%	NA
Temperate Japonica	767	97.10%	2.00%	0.91%	0.00%	NA
Tropical Japonica	504	58.30%	35.90%	2.38%	3.37%	NA
Japonica Intermediate	241	88.80%	8.70%	2.07%	0.41%	NA
VI/Aromatic	96	71.90%	0.00%	2.08%	26.04%	NA
Intermediate	90	82.20%	15.60%	1.11%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0421022965	G -> DEL	N	N	silent_mutation	Average:54.424; most accessible tissue: Callus, score: 79.62	N	N	N	N
vg0421022965	G -> A	LOC_Os04g34700.1	downstream_gene_variant ; 212.0bp to feature; MODIFIER	silent_mutation	Average:54.424; most accessible tissue: Callus, score: 79.62	N	N	N	N
vg0421022965	G -> A	LOC_Os04g34700-LOC_Os04g34690	intergenic_region ; MODIFIER	silent_mutation	Average:54.424; most accessible tissue: Callus, score: 79.62	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0421022965	NA	7.13E-06	mr1104	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421022965	NA	1.59E-06	mr1155	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421022965	NA	1.63E-06	mr1213	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421022965	1.87E-06	NA	mr1233	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421022965	NA	5.56E-07	mr1543	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421022965	NA	6.09E-06	mr1686	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421022965	8.12E-06	1.98E-07	mr1871	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421022965	2.25E-06	2.25E-06	mr1333_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421022965	NA	1.25E-06	mr1422_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421022965	NA	9.98E-06	mr1830_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251