\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0421021694:

Variant ID: vg0421021694 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 21021694
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 124. )

Flanking Sequence (100 bp) in Reference Genome:


TTTGTGTCCAAATGATTGTGAATGTGATTATTTTTGTGATTTGTGAATGCCTAATGAAGGCATGCGGCCAGCTGTGCTTTTAATATTTTATTTTTTTTGC[T/C]
GCATTTTTTAGTTTTGTGACGGGTCTCAATTCAGACCCTCCGTTACAGGTGAAGGTCACCTATGACGGATTTTACTTGCAGTCCGTCAAAGGTTACATTT

Reverse complement sequence

AAATGTAACCTTTGACGGACTGCAAGTAAAATCCGTCATAGGTGACCTTCACCTGTAACGGAGGGTCTGAATTGAGACCCGTCACAAAACTAAAAAATGC[A/G]
GCAAAAAAAATAAAATATTAAAAGCACAGCTGGCCGCATGCCTTCATTAGGCATTCACAAATCACAAAAATAATCACATTCACAATCATTTGGACACAAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.40% 26.70% 3.00% 17.86% NA
All Indica  2759 24.80% 44.90% 3.41% 26.97% NA
All Japonica  1512 96.40% 0.20% 0.26% 3.17% NA
Aus  269 76.60% 3.70% 14.87% 4.83% NA
Indica I  595 22.70% 58.20% 2.02% 17.14% NA
Indica II  465 12.50% 49.90% 6.24% 31.40% NA
Indica III  913 34.30% 35.80% 3.07% 26.83% NA
Indica Intermediate  786 22.50% 42.40% 3.18% 31.93% NA
Temperate Japonica  767 98.40% 0.10% 0.26% 1.17% NA
Tropical Japonica  504 92.70% 0.40% 0.40% 6.55% NA
Japonica Intermediate  241 97.50% 0.00% 0.00% 2.49% NA
VI/Aromatic  96 68.80% 1.00% 2.08% 28.12% NA
Intermediate  90 71.10% 13.30% 2.22% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0421021694 T -> C LOC_Os04g34710.1 downstream_gene_variant ; 4997.0bp to feature; MODIFIER silent_mutation Average:74.222; most accessible tissue: Minghui63 flag leaf, score: 98.908 N N N N
vg0421021694 T -> C LOC_Os04g34700.1 intron_variant ; MODIFIER silent_mutation Average:74.222; most accessible tissue: Minghui63 flag leaf, score: 98.908 N N N N
vg0421021694 T -> DEL N N silent_mutation Average:74.222; most accessible tissue: Minghui63 flag leaf, score: 98.908 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0421021694 T C -0.02 -0.01 -0.02 -0.01 -0.02 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0421021694 NA 2.13E-10 mr1720 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421021694 NA 7.08E-10 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421021694 NA 1.89E-13 mr1138_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421021694 NA 1.04E-08 mr1172_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421021694 NA 3.71E-06 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421021694 NA 9.07E-06 mr1184_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421021694 3.98E-06 3.98E-06 mr1267_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421021694 NA 4.14E-06 mr1278_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421021694 NA 6.99E-08 mr1329_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421021694 NA 8.66E-06 mr1337_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421021694 NA 1.72E-06 mr1397_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421021694 NA 2.10E-16 mr1457_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421021694 NA 8.39E-08 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421021694 NA 1.93E-06 mr1549_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421021694 NA 1.36E-23 mr1551_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421021694 NA 3.50E-14 mr1552_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421021694 NA 2.35E-07 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421021694 NA 1.08E-06 mr1683_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421021694 NA 5.41E-08 mr1690_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421021694 NA 1.41E-15 mr1720_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421021694 4.09E-06 1.00E-06 mr1757_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421021694 NA 2.69E-06 mr1950_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421021694 NA 4.84E-07 mr1982_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251