\
| Variant ID: vg0421019575 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 21019575 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TATAGATACTTTTTTTTTAAAAAAATGCACCGTTTAACAACCTAAAAAAAATGTGCACGTGGAACGCGAGGGAGATGGGTTGAGAACCATGCTACCGAAC[T/A]
AAGCCTGCCTTTTAGGAATTAGGCTTTGTTATCGGGTGGCGTTAGTTCACCCTTTTTCTTTTATCAAATAAAGTGACTCGTGTTTATTGGAGGAGCTAGC
GCTAGCTCCTCCAATAAACACGAGTCACTTTATTTGATAAAAGAAAAAGGGTGAACTAACGCCACCCGATAACAAAGCCTAATTCCTAAAAGGCAGGCTT[A/T]
GTTCGGTAGCATGGTTCTCAACCCATCTCCCTCGCGTTCCACGTGCACATTTTTTTTAGGTTGTTAAACGGTGCATTTTTTTAAAAAAAAAGTATCTATA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.40% | 6.50% | 0.21% | 0.85% | NA |
| All Indica | 2759 | 95.60% | 4.20% | 0.04% | 0.11% | NA |
| All Japonica | 1512 | 98.60% | 0.20% | 0.40% | 0.79% | NA |
| Aus | 269 | 33.80% | 66.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 93.00% | 6.90% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 93.60% | 6.00% | 0.00% | 0.38% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 96.00% | 0.60% | 1.19% | 2.18% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 65.60% | 6.20% | 2.08% | 26.04% | NA |
| Intermediate | 90 | 94.40% | 4.40% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0421019575 | T -> DEL | N | N | silent_mutation | Average:44.111; most accessible tissue: Callus, score: 88.008 | N | N | N | N |
| vg0421019575 | T -> A | LOC_Os04g34700.1 | upstream_gene_variant ; 981.0bp to feature; MODIFIER | silent_mutation | Average:44.111; most accessible tissue: Callus, score: 88.008 | N | N | N | N |
| vg0421019575 | T -> A | LOC_Os04g34710.1 | downstream_gene_variant ; 2878.0bp to feature; MODIFIER | silent_mutation | Average:44.111; most accessible tissue: Callus, score: 88.008 | N | N | N | N |
| vg0421019575 | T -> A | LOC_Os04g34710-LOC_Os04g34700 | intergenic_region ; MODIFIER | silent_mutation | Average:44.111; most accessible tissue: Callus, score: 88.008 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0421019575 | NA | 3.27E-06 | mr1058 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421019575 | NA | 1.25E-06 | mr1230 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421019575 | NA | 8.08E-07 | mr1320 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421019575 | NA | 3.82E-07 | mr1365 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421019575 | NA | 8.19E-06 | mr1545 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421019575 | NA | 1.21E-06 | mr1556 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421019575 | NA | 8.33E-06 | mr1569 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421019575 | NA | 3.13E-06 | mr1574 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421019575 | 1.61E-06 | NA | mr1864 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |