\
| Variant ID: vg0421019493 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 21019493 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GAAATGATCCATTAGTAGGTGATTAATTAAGTATTTGCTATTTTAAAAAATAGATCAATATAATTTTGTTAAGCAATTTTCGTATAGATACTTTTTTTTT[A/T]
AAAAAATGCACCGTTTAACAACCTAAAAAAAATGTGCACGTGGAACGCGAGGGAGATGGGTTGAGAACCATGCTACCGAACTAAGCCTGCCTTTTAGGAA
TTCCTAAAAGGCAGGCTTAGTTCGGTAGCATGGTTCTCAACCCATCTCCCTCGCGTTCCACGTGCACATTTTTTTTAGGTTGTTAAACGGTGCATTTTTT[T/A]
AAAAAAAAAGTATCTATACGAAAATTGCTTAACAAAATTATATTGATCTATTTTTTAAAATAGCAAATACTTAATTAATCACCTACTAATGGATCATTTC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 77.50% | 17.00% | 4.38% | 1.10% | NA |
| All Indica | 2759 | 77.20% | 20.20% | 2.43% | 0.14% | NA |
| All Japonica | 1512 | 75.90% | 14.10% | 8.66% | 1.32% | NA |
| Aus | 269 | 98.90% | 0.70% | 0.37% | 0.00% | NA |
| Indica I | 595 | 68.40% | 25.00% | 6.55% | 0.00% | NA |
| Indica II | 465 | 93.80% | 4.50% | 1.72% | 0.00% | NA |
| Indica III | 913 | 69.10% | 30.20% | 0.55% | 0.11% | NA |
| Indica Intermediate | 786 | 83.60% | 14.10% | 1.91% | 0.38% | NA |
| Temperate Japonica | 767 | 67.70% | 19.90% | 12.39% | 0.00% | NA |
| Tropical Japonica | 504 | 84.70% | 7.90% | 3.57% | 3.77% | NA |
| Japonica Intermediate | 241 | 83.80% | 8.30% | 7.47% | 0.41% | NA |
| VI/Aromatic | 96 | 45.80% | 24.00% | 2.08% | 28.12% | NA |
| Intermediate | 90 | 81.10% | 11.10% | 6.67% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0421019493 | A -> DEL | N | N | silent_mutation | Average:50.654; most accessible tissue: Callus, score: 88.008 | N | N | N | N |
| vg0421019493 | A -> T | LOC_Os04g34700.1 | upstream_gene_variant ; 1063.0bp to feature; MODIFIER | silent_mutation | Average:50.654; most accessible tissue: Callus, score: 88.008 | N | N | N | N |
| vg0421019493 | A -> T | LOC_Os04g34710.1 | downstream_gene_variant ; 2796.0bp to feature; MODIFIER | silent_mutation | Average:50.654; most accessible tissue: Callus, score: 88.008 | N | N | N | N |
| vg0421019493 | A -> T | LOC_Os04g34710-LOC_Os04g34700 | intergenic_region ; MODIFIER | silent_mutation | Average:50.654; most accessible tissue: Callus, score: 88.008 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0421019493 | NA | 1.50E-06 | mr1011_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421019493 | NA | 1.43E-06 | mr1015_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421019493 | NA | 1.14E-06 | mr1158_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421019493 | NA | 1.67E-06 | mr1158_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421019493 | NA | 8.36E-06 | mr1184_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421019493 | NA | 3.68E-06 | mr1184_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421019493 | NA | 3.36E-06 | mr1543_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421019493 | NA | 2.89E-06 | mr1682_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421019493 | NA | 2.51E-06 | mr1683_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421019493 | NA | 6.93E-06 | mr1812_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421019493 | NA | 4.38E-06 | mr1832_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421019493 | 3.54E-06 | 3.54E-06 | mr1832_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421019493 | NA | 8.80E-07 | mr1833_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421019493 | 1.38E-06 | 1.38E-06 | mr1833_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0421019493 | NA | 4.92E-06 | mr1977_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |