\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0421019493:

Variant ID: vg0421019493 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 21019493
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAAATGATCCATTAGTAGGTGATTAATTAAGTATTTGCTATTTTAAAAAATAGATCAATATAATTTTGTTAAGCAATTTTCGTATAGATACTTTTTTTTT[A/T]
AAAAAATGCACCGTTTAACAACCTAAAAAAAATGTGCACGTGGAACGCGAGGGAGATGGGTTGAGAACCATGCTACCGAACTAAGCCTGCCTTTTAGGAA

Reverse complement sequence

TTCCTAAAAGGCAGGCTTAGTTCGGTAGCATGGTTCTCAACCCATCTCCCTCGCGTTCCACGTGCACATTTTTTTTAGGTTGTTAAACGGTGCATTTTTT[T/A]
AAAAAAAAAGTATCTATACGAAAATTGCTTAACAAAATTATATTGATCTATTTTTTAAAATAGCAAATACTTAATTAATCACCTACTAATGGATCATTTC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.50% 17.00% 4.38% 1.10% NA
All Indica  2759 77.20% 20.20% 2.43% 0.14% NA
All Japonica  1512 75.90% 14.10% 8.66% 1.32% NA
Aus  269 98.90% 0.70% 0.37% 0.00% NA
Indica I  595 68.40% 25.00% 6.55% 0.00% NA
Indica II  465 93.80% 4.50% 1.72% 0.00% NA
Indica III  913 69.10% 30.20% 0.55% 0.11% NA
Indica Intermediate  786 83.60% 14.10% 1.91% 0.38% NA
Temperate Japonica  767 67.70% 19.90% 12.39% 0.00% NA
Tropical Japonica  504 84.70% 7.90% 3.57% 3.77% NA
Japonica Intermediate  241 83.80% 8.30% 7.47% 0.41% NA
VI/Aromatic  96 45.80% 24.00% 2.08% 28.12% NA
Intermediate  90 81.10% 11.10% 6.67% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0421019493 A -> DEL N N silent_mutation Average:50.654; most accessible tissue: Callus, score: 88.008 N N N N
vg0421019493 A -> T LOC_Os04g34700.1 upstream_gene_variant ; 1063.0bp to feature; MODIFIER silent_mutation Average:50.654; most accessible tissue: Callus, score: 88.008 N N N N
vg0421019493 A -> T LOC_Os04g34710.1 downstream_gene_variant ; 2796.0bp to feature; MODIFIER silent_mutation Average:50.654; most accessible tissue: Callus, score: 88.008 N N N N
vg0421019493 A -> T LOC_Os04g34710-LOC_Os04g34700 intergenic_region ; MODIFIER silent_mutation Average:50.654; most accessible tissue: Callus, score: 88.008 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0421019493 NA 1.50E-06 mr1011_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421019493 NA 1.43E-06 mr1015_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421019493 NA 1.14E-06 mr1158_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421019493 NA 1.67E-06 mr1158_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421019493 NA 8.36E-06 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421019493 NA 3.68E-06 mr1184_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421019493 NA 3.36E-06 mr1543_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421019493 NA 2.89E-06 mr1682_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421019493 NA 2.51E-06 mr1683_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421019493 NA 6.93E-06 mr1812_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421019493 NA 4.38E-06 mr1832_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421019493 3.54E-06 3.54E-06 mr1832_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421019493 NA 8.80E-07 mr1833_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421019493 1.38E-06 1.38E-06 mr1833_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421019493 NA 4.92E-06 mr1977_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251