\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0421016929:

Variant ID: vg0421016929 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 21016929
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.84, C: 0.15, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


TCCTTATTTTGGTTTTTCCAATTTAAGTGTGTTCTATTTTATATTTGATCTATACTATTATCTCGAGTGATACTTTGTAATAATTGGCTGTAGCTCCTCT[C/T]
GAGCAAAGGTCGGAATATTATATTCCATTATCTAAAAAATATACATATTTTTCATAACTATCTTTGGCGTAATGTACGTTCTTTTTATTCTCCTTGACAA

Reverse complement sequence

TTGTCAAGGAGAATAAAAAGAACGTACATTACGCCAAAGATAGTTATGAAAAATATGTATATTTTTTAGATAATGGAATATAATATTCCGACCTTTGCTC[G/A]
AGAGGAGCTACAGCCAATTATTACAAAGTATCACTCGAGATAATAGTATAGATCAAATATAAAATAGAACACACTTAAATTGGAAAAACCAAAATAAGGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.40% 47.30% 0.17% 1.18% NA
All Indica  2759 27.00% 72.50% 0.25% 0.22% NA
All Japonica  1512 98.20% 0.50% 0.00% 1.32% NA
Aus  269 28.30% 71.70% 0.00% 0.00% NA
Indica I  595 38.50% 61.30% 0.17% 0.00% NA
Indica II  465 11.40% 88.00% 0.43% 0.22% NA
Indica III  913 32.70% 66.90% 0.22% 0.11% NA
Indica Intermediate  786 21.00% 78.20% 0.25% 0.51% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 95.40% 0.80% 0.00% 3.77% NA
Japonica Intermediate  241 99.20% 0.40% 0.00% 0.41% NA
VI/Aromatic  96 57.30% 12.50% 0.00% 30.21% NA
Intermediate  90 72.20% 25.60% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0421016929 C -> DEL N N silent_mutation Average:33.844; most accessible tissue: Callus, score: 62.692 N N N N
vg0421016929 C -> T LOC_Os04g34700.1 upstream_gene_variant ; 3627.0bp to feature; MODIFIER silent_mutation Average:33.844; most accessible tissue: Callus, score: 62.692 N N N N
vg0421016929 C -> T LOC_Os04g34710.1 downstream_gene_variant ; 232.0bp to feature; MODIFIER silent_mutation Average:33.844; most accessible tissue: Callus, score: 62.692 N N N N
vg0421016929 C -> T LOC_Os04g34710-LOC_Os04g34700 intergenic_region ; MODIFIER silent_mutation Average:33.844; most accessible tissue: Callus, score: 62.692 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0421016929 NA 6.32E-10 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421016929 NA 2.17E-07 mr1011_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421016929 NA 1.75E-06 mr1015_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421016929 NA 1.80E-06 mr1158_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421016929 NA 2.26E-07 mr1167_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421016929 NA 9.27E-09 mr1172_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421016929 NA 1.28E-07 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421016929 NA 9.85E-07 mr1184_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421016929 NA 2.56E-06 mr1278_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421016929 NA 1.19E-07 mr1329_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421016929 NA 2.15E-19 mr1336_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421016929 4.32E-06 4.32E-06 mr1374_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421016929 NA 4.00E-07 mr1397_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421016929 NA 1.57E-07 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421016929 9.63E-06 6.80E-07 mr1549_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421016929 NA 1.02E-18 mr1579_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421016929 NA 4.64E-13 mr1636_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421016929 NA 1.13E-06 mr1641_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421016929 NA 5.52E-18 mr1682_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421016929 NA 7.84E-11 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421016929 3.21E-06 1.16E-08 mr1683_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421016929 NA 3.59E-06 mr1687_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421016929 NA 8.95E-11 mr1794_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421016929 7.17E-07 NA mr1808_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421016929 2.95E-06 2.95E-06 mr1812_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421016929 6.82E-06 6.82E-06 mr1832_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421016929 6.43E-06 6.43E-06 mr1833_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421016929 NA 1.02E-14 mr1838_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421016929 NA 5.18E-07 mr1838_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421016929 NA 3.01E-07 mr1950_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421016929 NA 2.28E-06 mr1982_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251