Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0421016689:

Variant ID: vg0421016689 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 21016689
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:

CATTTGTTGGGCTCTATGGTTGAGTAGAAATGATATGGTTTTTGATAAATCACTATATATTTCCTATATGCAGGTAATTTTCAGGGCAACTCATTGGCTT[C/T]
GGTTTTAGGCACAATTACAAAGGTGTGATGAAGATGGAGAGTTTCTGAAAGTTGCATGTCGTAAGTTGGAGACAATTGTTATGCAACTTTATGCCAACTA

Reverse complement sequence

TAGTTGGCATAAAGTTGCATAACAATTGTCTCCAACTTACGACATGCAACTTTCAGAAACTCTCCATCTTCATCACACCTTTGTAATTGTGCCTAAAACC[G/A]
AAGCCAATGAGTTGCCCTGAAAATTACCTGCATATAGGAAATATATAGTGATTTATCAAAAACCATATCATTTCTACTCAACCATAGAGCCCAACAAATG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	85.80%	12.40%	0.80%	0.99%	NA
All Indica	2759	78.20%	20.60%	1.05%	0.14%	NA
All Japonica	1512	98.40%	0.10%	0.40%	1.12%	NA
Aus	269	98.10%	1.90%	0.00%	0.00%	NA
Indica I	595	72.40%	24.50%	3.03%	0.00%	NA
Indica II	465	94.60%	4.70%	0.65%	0.00%	NA
Indica III	913	68.00%	31.40%	0.44%	0.11%	NA
Indica Intermediate	786	84.70%	14.40%	0.51%	0.38%	NA
Temperate Japonica	767	99.60%	0.00%	0.39%	0.00%	NA
Tropical Japonica	504	96.40%	0.00%	0.40%	3.17%	NA
Japonica Intermediate	241	98.80%	0.40%	0.41%	0.41%	NA
VI/Aromatic	96	67.70%	4.20%	2.08%	26.04%	NA
Intermediate	90	91.10%	6.70%	1.11%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0421016689	C -> DEL	LOC_Os04g34710.1	N	frameshift_variant	Average:27.236; most accessible tissue: Zhenshan97 panicle, score: 52.263	N	N	N	N
vg0421016689	C -> T	LOC_Os04g34710.1	missense_variant ; p.Arg54Trp; MODERATE	nonsynonymous_codon ; R54W	Average:27.236; most accessible tissue: Zhenshan97 panicle, score: 52.263	unknown	unknown	DELETERIOUS	0.00

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0421016689	NA	2.58E-06	mr1274	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421016689	NA	2.25E-06	mr1011_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421016689	NA	7.51E-07	mr1015_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421016689	NA	9.93E-08	mr1158_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421016689	NA	5.41E-07	mr1158_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421016689	NA	8.79E-07	mr1167_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421016689	NA	2.33E-06	mr1184_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421016689	NA	7.88E-06	mr1245_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421016689	3.82E-06	3.81E-06	mr1267_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421016689	2.37E-06	2.37E-06	mr1312_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421016689	NA	7.92E-06	mr1332_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421016689	NA	6.24E-06	mr1373_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421016689	5.34E-06	5.34E-06	mr1374_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421016689	NA	1.60E-06	mr1397_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421016689	5.16E-06	3.49E-08	mr1397_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421016689	NA	7.22E-06	mr1445_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421016689	NA	9.42E-06	mr1445_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421016689	9.32E-06	2.84E-06	mr1549_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421016689	NA	8.62E-06	mr1655_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421016689	NA	2.41E-07	mr1683_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421016689	7.08E-06	7.08E-06	mr1738_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421016689	NA	2.59E-06	mr1766_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421016689	NA	6.08E-11	mr1794_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421016689	5.70E-06	5.70E-06	mr1832_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421016689	2.42E-06	2.42E-06	mr1833_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421016689	NA	1.66E-06	mr1950_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251