\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0421015426:

Variant ID: vg0421015426 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 21015426
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.67, C: 0.33, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:


TTATGCAAGATAACACATGTAGCTGCAAGGAAGCTAATTCTTGGAGACCTTATAATAACGTGGTGGAATATTTGGCTAGAACGAAACAGAAGAATTCTCT[C/G]
TCACCCTTCACAAAACGAGAACCAGGTGGCCTCCTTAATCAAGGAAAATATAAGCCAAATAAATCTGTCCAGAGGTTAAATGTTGCTGTTTTTCAAGTTG

Reverse complement sequence

CAACTTGAAAAACAGCAACATTTAACCTCTGGACAGATTTATTTGGCTTATATTTTCCTTGATTAAGGAGGCCACCTGGTTCTCGTTTTGTGAAGGGTGA[G/C]
AGAGAATTCTTCTGTTTCGTTCTAGCCAAATATTCCACCACGTTATTATAAGGTCTCCAAGAATTAGCTTCCTTGCAGCTACATGTGTTATCTTGCATAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.10% 47.40% 0.17% 1.38% NA
All Indica  2759 26.80% 72.50% 0.25% 0.47% NA
All Japonica  1512 98.10% 0.50% 0.00% 1.32% NA
Aus  269 27.10% 72.90% 0.00% 0.00% NA
Indica I  595 38.20% 61.50% 0.17% 0.17% NA
Indica II  465 11.00% 88.00% 0.43% 0.65% NA
Indica III  913 32.60% 66.80% 0.22% 0.33% NA
Indica Intermediate  786 20.70% 78.20% 0.25% 0.76% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 95.40% 0.80% 0.00% 3.77% NA
Japonica Intermediate  241 99.20% 0.40% 0.00% 0.41% NA
VI/Aromatic  96 56.20% 12.50% 0.00% 31.25% NA
Intermediate  90 70.00% 26.70% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0421015426 C -> DEL N N silent_mutation Average:47.413; most accessible tissue: Callus, score: 73.893 N N N N
vg0421015426 C -> G LOC_Os04g34710.1 upstream_gene_variant ; 329.0bp to feature; MODIFIER silent_mutation Average:47.413; most accessible tissue: Callus, score: 73.893 N N N N
vg0421015426 C -> G LOC_Os04g34720.1 downstream_gene_variant ; 4689.0bp to feature; MODIFIER silent_mutation Average:47.413; most accessible tissue: Callus, score: 73.893 N N N N
vg0421015426 C -> G LOC_Os04g34720.2 downstream_gene_variant ; 4689.0bp to feature; MODIFIER silent_mutation Average:47.413; most accessible tissue: Callus, score: 73.893 N N N N
vg0421015426 C -> G LOC_Os04g34720-LOC_Os04g34710 intergenic_region ; MODIFIER silent_mutation Average:47.413; most accessible tissue: Callus, score: 73.893 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0421015426 NA 7.62E-10 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421015426 NA 1.98E-07 mr1011_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421015426 NA 1.57E-06 mr1015_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421015426 NA 1.90E-06 mr1158_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421015426 NA 2.46E-07 mr1167_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421015426 NA 8.03E-09 mr1172_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421015426 NA 1.62E-07 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421015426 NA 9.39E-07 mr1184_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421015426 NA 2.69E-06 mr1278_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421015426 NA 7.47E-08 mr1329_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421015426 NA 7.18E-08 mr1335_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421015426 NA 1.24E-19 mr1336_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421015426 NA 1.21E-09 mr1338_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421015426 4.45E-06 4.44E-06 mr1374_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421015426 NA 4.51E-07 mr1397_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421015426 NA 1.31E-07 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421015426 NA 6.96E-07 mr1549_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421015426 NA 9.00E-19 mr1579_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421015426 NA 2.44E-12 mr1636_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421015426 NA 1.34E-06 mr1641_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421015426 NA 3.18E-18 mr1682_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421015426 NA 1.07E-10 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421015426 3.30E-06 1.20E-08 mr1683_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421015426 NA 5.40E-06 mr1687_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421015426 NA 7.15E-11 mr1794_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421015426 6.26E-06 NA mr1808_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421015426 3.52E-06 3.51E-06 mr1812_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421015426 7.49E-06 7.49E-06 mr1832_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421015426 6.82E-06 6.82E-06 mr1833_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421015426 NA 4.91E-14 mr1838_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421015426 NA 5.93E-07 mr1838_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421015426 NA 3.00E-07 mr1950_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0421015426 NA 7.30E-07 mr1982_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251