\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0420986488:

Variant ID: vg0420986488 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 20986488
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTCAGCTGTAGCCTGGAAGTAAAGCAATCGTCAGTTTCTTTTGAGGTTGCTCTGTCTTCTGATTGTTTGCCTGGGTATGAATATTACCTTGTGATTTTCA[C/T]
GTTGCTACGTAGAAGATCTGAAAGGATTCGATCCATCTTTTTCCTTGTGTCTTACTAAAAGAAATTAGCATGCAGTATGCGAAATGTTAAGTTTGCTTAT

Reverse complement sequence

ATAAGCAAACTTAACATTTCGCATACTGCATGCTAATTTCTTTTAGTAAGACACAAGGAAAAAGATGGATCGAATCCTTTCAGATCTTCTACGTAGCAAC[G/A]
TGAAAATCACAAGGTAATATTCATACCCAGGCAAACAATCAGAAGACAGAGCAACCTCAAAAGAAACTGACGATTGCTTTACTTCCAGGCTACAGCTGAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.10% 5.10% 8.40% 18.35% NA
All Indica  2759 58.50% 0.50% 13.16% 27.84% NA
All Japonica  1512 78.10% 14.20% 1.52% 6.15% NA
Aus  269 97.80% 0.40% 1.49% 0.37% NA
Indica I  595 84.00% 0.00% 5.21% 10.76% NA
Indica II  465 34.80% 1.70% 19.14% 44.30% NA
Indica III  913 60.90% 0.00% 13.80% 25.30% NA
Indica Intermediate  786 50.30% 0.90% 14.89% 33.97% NA
Temperate Japonica  767 97.50% 1.60% 0.78% 0.13% NA
Tropical Japonica  504 45.20% 36.10% 2.98% 15.67% NA
Japonica Intermediate  241 85.10% 8.70% 0.83% 5.39% NA
VI/Aromatic  96 99.00% 0.00% 0.00% 1.04% NA
Intermediate  90 74.40% 13.30% 7.78% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0420986488 C -> DEL N N silent_mutation Average:10.849; most accessible tissue: Zhenshan97 root, score: 20.427 N N N N
vg0420986488 C -> T LOC_Os04g34699.1 upstream_gene_variant ; 4857.0bp to feature; MODIFIER silent_mutation Average:10.849; most accessible tissue: Zhenshan97 root, score: 20.427 N N N N
vg0420986488 C -> T LOC_Os04g34680-LOC_Os04g34699 intergenic_region ; MODIFIER silent_mutation Average:10.849; most accessible tissue: Zhenshan97 root, score: 20.427 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0420986488 4.72E-06 NA mr1076 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420986488 NA 1.23E-06 mr1104 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420986488 NA 8.18E-06 mr1155 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420986488 3.29E-06 4.36E-09 mr1213 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420986488 3.21E-06 NA mr1233 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420986488 NA 1.39E-06 mr1246 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420986488 6.44E-07 NA mr1411 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420986488 NA 7.01E-07 mr1620 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420986488 NA 6.49E-06 mr1642 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420986488 7.85E-06 NA mr1949 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0420986488 NA 3.88E-07 mr1951 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251