\
| Variant ID: vg0420986488 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 20986488 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GTCAGCTGTAGCCTGGAAGTAAAGCAATCGTCAGTTTCTTTTGAGGTTGCTCTGTCTTCTGATTGTTTGCCTGGGTATGAATATTACCTTGTGATTTTCA[C/T]
GTTGCTACGTAGAAGATCTGAAAGGATTCGATCCATCTTTTTCCTTGTGTCTTACTAAAAGAAATTAGCATGCAGTATGCGAAATGTTAAGTTTGCTTAT
ATAAGCAAACTTAACATTTCGCATACTGCATGCTAATTTCTTTTAGTAAGACACAAGGAAAAAGATGGATCGAATCCTTTCAGATCTTCTACGTAGCAAC[G/A]
TGAAAATCACAAGGTAATATTCATACCCAGGCAAACAATCAGAAGACAGAGCAACCTCAAAAGAAACTGACGATTGCTTTACTTCCAGGCTACAGCTGAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 68.10% | 5.10% | 8.40% | 18.35% | NA |
| All Indica | 2759 | 58.50% | 0.50% | 13.16% | 27.84% | NA |
| All Japonica | 1512 | 78.10% | 14.20% | 1.52% | 6.15% | NA |
| Aus | 269 | 97.80% | 0.40% | 1.49% | 0.37% | NA |
| Indica I | 595 | 84.00% | 0.00% | 5.21% | 10.76% | NA |
| Indica II | 465 | 34.80% | 1.70% | 19.14% | 44.30% | NA |
| Indica III | 913 | 60.90% | 0.00% | 13.80% | 25.30% | NA |
| Indica Intermediate | 786 | 50.30% | 0.90% | 14.89% | 33.97% | NA |
| Temperate Japonica | 767 | 97.50% | 1.60% | 0.78% | 0.13% | NA |
| Tropical Japonica | 504 | 45.20% | 36.10% | 2.98% | 15.67% | NA |
| Japonica Intermediate | 241 | 85.10% | 8.70% | 0.83% | 5.39% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 74.40% | 13.30% | 7.78% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0420986488 | C -> DEL | N | N | silent_mutation | Average:10.849; most accessible tissue: Zhenshan97 root, score: 20.427 | N | N | N | N |
| vg0420986488 | C -> T | LOC_Os04g34699.1 | upstream_gene_variant ; 4857.0bp to feature; MODIFIER | silent_mutation | Average:10.849; most accessible tissue: Zhenshan97 root, score: 20.427 | N | N | N | N |
| vg0420986488 | C -> T | LOC_Os04g34680-LOC_Os04g34699 | intergenic_region ; MODIFIER | silent_mutation | Average:10.849; most accessible tissue: Zhenshan97 root, score: 20.427 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0420986488 | 4.72E-06 | NA | mr1076 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420986488 | NA | 1.23E-06 | mr1104 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420986488 | NA | 8.18E-06 | mr1155 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420986488 | 3.29E-06 | 4.36E-09 | mr1213 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420986488 | 3.21E-06 | NA | mr1233 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420986488 | NA | 1.39E-06 | mr1246 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420986488 | 6.44E-07 | NA | mr1411 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420986488 | NA | 7.01E-07 | mr1620 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420986488 | NA | 6.49E-06 | mr1642 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420986488 | 7.85E-06 | NA | mr1949 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0420986488 | NA | 3.88E-07 | mr1951 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |